\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105481161:

Variant ID: vg0105481161 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 5481161
Reference Allele: CATCCCTCCTCTTTAlternative Allele: GATCCCTCCTCTTT,TATCCCTCCTCTTT,C
Primary Allele: CATCCCTCCTCTTTSecondary Allele: GATCCCTCCTCTTT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCTCCCGCTCAGGCACGGCCCACCAGCTGTCGGGTCGTGCCGGGCCGGCCCGAAGGCACGGGTGGCCCATCGTGCCTTTTTTAAATAAGTCTACTTTT[CATCCCTCCTCTTT/GATCCCTCCTCTTT,TATCCCTCCTCTTT,C]
GCGCTGTGACATATTATAGCGAAAATAAGTCTATTTTCCATCCCTCCACTTTGGGCTGTGACATATATATAGTGAAAATAAGTCTATTTTTCGTCCCTCC

Reverse complement sequence

GGAGGGACGAAAAATAGACTTATTTTCACTATATATATGTCACAGCCCAAAGTGGAGGGATGGAAAATAGACTTATTTTCGCTATAATATGTCACAGCGC[AAAGAGGAGGGATG/AAAGAGGAGGGATC,AAAGAGGAGGGATA,G]
AAAAGTAGACTTATTTAAAAAAGGCACGATGGGCCACCCGTGCCTTCGGGCCGGCCCGGCACGACCCGACAGCTGGTGGGCCGTGCCTGAGCGGGAGGCG

Allele Frequencies:

Populations Population SizeFrequency of CATCCCTCCTCTTT(primary allele) Frequency of GATCCCTCCTCTTT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 3.00% 2.41% 11.13% TATCCCTCCTCTTT: 0.02%; C: 0.02%
All Indica  2759 78.90% 0.10% 2.43% 18.48% NA
All Japonica  1512 87.80% 8.80% 2.84% 0.40% TATCCCTCCTCTTT: 0.07%; C: 0.07%
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 97.80% 0.00% 0.17% 2.02% NA
Indica II  465 55.90% 0.00% 6.24% 37.85% NA
Indica III  913 79.60% 0.00% 2.08% 18.29% NA
Indica Intermediate  786 77.50% 0.50% 2.29% 19.72% NA
Temperate Japonica  767 97.30% 0.00% 2.22% 0.52% NA
Tropical Japonica  504 70.00% 25.00% 4.37% 0.20% TATCCCTCCTCTTT: 0.20%; C: 0.20%
Japonica Intermediate  241 95.00% 2.90% 1.66% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 3.30% 4.44% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105481161 CATCCCTCCTCTTT -> TATCCCTCCTCTTT LOC_Os01g10400.1 downstream_gene_variant ; 1327.0bp to feature; MODIFIER silent_mutation Average:97.552; most accessible tissue: Zhenshan97 flag leaf, score: 99.947 N N N N
vg0105481161 CATCCCTCCTCTTT -> TATCCCTCCTCTTT LOC_Os01g10410.1 downstream_gene_variant ; 4403.0bp to feature; MODIFIER silent_mutation Average:97.552; most accessible tissue: Zhenshan97 flag leaf, score: 99.947 N N N N
vg0105481161 CATCCCTCCTCTTT -> TATCCCTCCTCTTT LOC_Os01g10400.2 downstream_gene_variant ; 1325.0bp to feature; MODIFIER silent_mutation Average:97.552; most accessible tissue: Zhenshan97 flag leaf, score: 99.947 N N N N
vg0105481161 CATCCCTCCTCTTT -> TATCCCTCCTCTTT LOC_Os01g10400-LOC_Os01g10410 intergenic_region ; MODIFIER silent_mutation Average:97.552; most accessible tissue: Zhenshan97 flag leaf, score: 99.947 N N N N
vg0105481161 CATCCCTCCTCTTT -> DEL N N silent_mutation Average:97.552; most accessible tissue: Zhenshan97 flag leaf, score: 99.947 N N N N
vg0105481161 CATCCCTCCTCTTT -> C LOC_Os01g10400.1 downstream_gene_variant ; 1328.0bp to feature; MODIFIER N Average:97.552; most accessible tissue: Zhenshan97 flag leaf, score: 99.947 N N N N
vg0105481161 CATCCCTCCTCTTT -> C LOC_Os01g10410.1 downstream_gene_variant ; 4402.0bp to feature; MODIFIER N Average:97.552; most accessible tissue: Zhenshan97 flag leaf, score: 99.947 N N N N
vg0105481161 CATCCCTCCTCTTT -> C LOC_Os01g10400.2 downstream_gene_variant ; 1326.0bp to feature; MODIFIER N Average:97.552; most accessible tissue: Zhenshan97 flag leaf, score: 99.947 N N N N
vg0105481161 CATCCCTCCTCTTT -> C LOC_Os01g10400-LOC_Os01g10410 intergenic_region ; MODIFIER N Average:97.552; most accessible tissue: Zhenshan97 flag leaf, score: 99.947 N N N N
vg0105481161 CATCCCTCCTCTTT -> GATCCCTCCTCTTT LOC_Os01g10400.1 downstream_gene_variant ; 1327.0bp to feature; MODIFIER silent_mutation Average:97.552; most accessible tissue: Zhenshan97 flag leaf, score: 99.947 N N N N
vg0105481161 CATCCCTCCTCTTT -> GATCCCTCCTCTTT LOC_Os01g10410.1 downstream_gene_variant ; 4403.0bp to feature; MODIFIER silent_mutation Average:97.552; most accessible tissue: Zhenshan97 flag leaf, score: 99.947 N N N N
vg0105481161 CATCCCTCCTCTTT -> GATCCCTCCTCTTT LOC_Os01g10400.2 downstream_gene_variant ; 1325.0bp to feature; MODIFIER silent_mutation Average:97.552; most accessible tissue: Zhenshan97 flag leaf, score: 99.947 N N N N
vg0105481161 CATCCCTCCTCTTT -> GATCCCTCCTCTTT LOC_Os01g10400-LOC_Os01g10410 intergenic_region ; MODIFIER silent_mutation Average:97.552; most accessible tissue: Zhenshan97 flag leaf, score: 99.947 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0105481161 CATCC* C -0.39 -0.13 -0.12 -0.32 -0.27 -0.32
vg0105481161 CATCC* GATCC* -0.1 -0.09 -0.1 -0.1 -0.08 -0.08
vg0105481161 CATCC* TATCC* -0.09 -0.07 -0.06 -0.08 -0.06 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105481161 NA 9.99E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105481161 NA 1.09E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105481161 4.67E-06 4.67E-06 mr1664 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105481161 NA 1.24E-06 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105481161 9.55E-07 9.55E-07 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105481161 NA 3.02E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105481161 NA 3.18E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105481161 NA 2.16E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251