Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105475832:

Variant ID: vg0105475832 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5475832
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGTATTTAAATCTCCGTATGAGCAAATTTCAGATTAATCAAGAATTCAAATCTCCATGTGAGCGAATTTCAGATTTGGTTGTTTAAGGGGCTTAAGTT[C/T]
CCAATTTTAAAAGATTGTATATATCCGGCCTAGTAAAAAAATACTATTCTAAAAAAAAGTAACGAGGGGCAGGTGAATGGACTTTTTGCTGATGACAATA

Reverse complement sequence

TATTGTCATCAGCAAAAAGTCCATTCACCTGCCCCTCGTTACTTTTTTTTAGAATAGTATTTTTTTACTAGGCCGGATATATACAATCTTTTAAAATTGG[G/A]
AACTTAAGCCCCTTAAACAACCAAATCTGAAATTCGCTCACATGGAGATTTGAATTCTTGATTAATCTGAAATTTGCTCATACGGAGATTTAAATACTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 25.00% 0.13% 0.00% NA
All Indica  2759 97.60% 2.40% 0.00% 0.00% NA
All Japonica  1512 32.30% 67.40% 0.33% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.70% 0.00% 0.00% NA
Temperate Japonica  767 51.20% 48.60% 0.13% 0.00% NA
Tropical Japonica  504 4.60% 94.80% 0.60% 0.00% NA
Japonica Intermediate  241 29.90% 69.70% 0.41% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105475832 C -> T LOC_Os01g10400.1 upstream_gene_variant ; 2644.0bp to feature; MODIFIER silent_mutation Average:98.017; most accessible tissue: Minghui63 young leaf, score: 98.746 N N N N
vg0105475832 C -> T LOC_Os01g10400.2 upstream_gene_variant ; 2644.0bp to feature; MODIFIER silent_mutation Average:98.017; most accessible tissue: Minghui63 young leaf, score: 98.746 N N N N
vg0105475832 C -> T LOC_Os01g10390.1 downstream_gene_variant ; 2819.0bp to feature; MODIFIER silent_mutation Average:98.017; most accessible tissue: Minghui63 young leaf, score: 98.746 N N N N
vg0105475832 C -> T LOC_Os01g10390-LOC_Os01g10400 intergenic_region ; MODIFIER silent_mutation Average:98.017; most accessible tissue: Minghui63 young leaf, score: 98.746 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0105475832 C T 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105475832 NA 1.30E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105475832 NA 4.78E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105475832 NA 1.72E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105475832 NA 1.33E-19 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105475832 NA 1.77E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105475832 4.78E-06 NA mr1460_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105475832 4.76E-06 4.76E-06 mr1460_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251