\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105467672:

Variant ID: vg0105467672 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5467672
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TATATGCGATAATTACAATTTTTAAAATTTTTAAATCATGCATGTGGCATTTACATATGTTAATTAGAGTTTTTAACAATTAGTTCAATATCATTCATAT[G/A]
CTAATTATATATGACTATTCGAATTTTTAAAATTTTCAAATCATGCATGTGGCATTCACATATGTTAATTAGAGTTCTTAACAATTAATTTAATATCCTA

Reverse complement sequence

TAGGATATTAAATTAATTGTTAAGAACTCTAATTAACATATGTGAATGCCACATGCATGATTTGAAAATTTTAAAAATTCGAATAGTCATATATAATTAG[C/T]
ATATGAATGATATTGAACTAATTGTTAAAAACTCTAATTAACATATGTAAATGCCACATGCATGATTTAAAAATTTTAAAAATTGTAATTATCGCATATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.60% 11.10% 14.66% 0.63% NA
All Indica  2759 56.00% 18.50% 24.47% 1.05% NA
All Japonica  1512 99.30% 0.20% 0.40% 0.07% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 96.10% 2.00% 1.51% 0.34% NA
Indica II  465 39.80% 13.50% 43.23% 3.44% NA
Indica III  913 31.70% 35.70% 32.53% 0.11% NA
Indica Intermediate  786 63.40% 14.00% 21.37% 1.27% NA
Temperate Japonica  767 99.10% 0.10% 0.65% 0.13% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 75.60% 12.20% 12.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105467672 G -> A LOC_Os01g10390.1 upstream_gene_variant ; 2447.0bp to feature; MODIFIER silent_mutation Average:13.989; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0105467672 G -> A LOC_Os01g10380.1 downstream_gene_variant ; 230.0bp to feature; MODIFIER silent_mutation Average:13.989; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0105467672 G -> A LOC_Os01g10380-LOC_Os01g10390 intergenic_region ; MODIFIER silent_mutation Average:13.989; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0105467672 G -> DEL N N silent_mutation Average:13.989; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105467672 7.58E-06 NA mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672 2.01E-06 2.01E-06 mr1916 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672 NA 2.24E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672 NA 7.08E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672 NA 9.71E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672 NA 5.84E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672 NA 4.09E-09 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672 NA 5.01E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672 NA 5.73E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672 NA 2.72E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672 2.97E-06 8.11E-09 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672 NA 4.33E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672 NA 1.14E-08 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672 NA 1.17E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672 NA 2.38E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251