Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105467672:

Variant ID: vg0105467672 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5467672
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TATATGCGATAATTACAATTTTTAAAATTTTTAAATCATGCATGTGGCATTTACATATGTTAATTAGAGTTTTTAACAATTAGTTCAATATCATTCATAT[G/A]
CTAATTATATATGACTATTCGAATTTTTAAAATTTTCAAATCATGCATGTGGCATTCACATATGTTAATTAGAGTTCTTAACAATTAATTTAATATCCTA

Reverse complement sequence

TAGGATATTAAATTAATTGTTAAGAACTCTAATTAACATATGTGAATGCCACATGCATGATTTGAAAATTTTAAAAATTCGAATAGTCATATATAATTAG[C/T]
ATATGAATGATATTGAACTAATTGTTAAAAACTCTAATTAACATATGTAAATGCCACATGCATGATTTAAAAATTTTAAAAATTGTAATTATCGCATATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.60%	11.10%	14.66%	0.63%	NA
All Indica	2759	56.00%	18.50%	24.47%	1.05%	NA
All Japonica	1512	99.30%	0.20%	0.40%	0.07%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	96.10%	2.00%	1.51%	0.34%	NA
Indica II	465	39.80%	13.50%	43.23%	3.44%	NA
Indica III	913	31.70%	35.70%	32.53%	0.11%	NA
Indica Intermediate	786	63.40%	14.00%	21.37%	1.27%	NA
Temperate Japonica	767	99.10%	0.10%	0.65%	0.13%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	12.20%	12.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105467672	G -> A	LOC_Os01g10390.1	upstream_gene_variant ; 2447.0bp to feature; MODIFIER	silent_mutation	Average:13.989; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0105467672	G -> A	LOC_Os01g10380.1	downstream_gene_variant ; 230.0bp to feature; MODIFIER	silent_mutation	Average:13.989; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0105467672	G -> A	LOC_Os01g10380-LOC_Os01g10390	intergenic_region ; MODIFIER	silent_mutation	Average:13.989; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0105467672	G -> DEL	N	N	silent_mutation	Average:13.989; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105467672	7.58E-06	NA	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672	2.01E-06	2.01E-06	mr1916	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672	NA	2.24E-06	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672	NA	7.08E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672	NA	9.71E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672	NA	5.84E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672	NA	4.09E-09	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672	NA	5.01E-06	mr1636_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672	NA	5.73E-06	mr1706_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672	NA	2.72E-06	mr1706_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672	2.97E-06	8.11E-09	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672	NA	4.33E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672	NA	1.14E-08	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672	NA	1.17E-06	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467672	NA	2.38E-06	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251