\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105459915:

Variant ID: vg0105459915 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5459915
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTCGGAATTAAATATAAGCAATATCGAAATAAGAGTATTTATAAGAACCCAATAGTAGATTAATTAAAATTTAGAATAAAGAATAAAATAAAAATCC[G/A]
AAATTAGGCAAATTAAAAAGAGAGTTAAAGTAGGAATACAATTTTGAAACAACTGAAATTGAAAATAAAAAATAAAAAATATCAGAAGAACACAATACGA

Reverse complement sequence

TCGTATTGTGTTCTTCTGATATTTTTTATTTTTTATTTTCAATTTCAGTTGTTTCAAAATTGTATTCCTACTTTAACTCTCTTTTTAATTTGCCTAATTT[C/T]
GGATTTTTATTTTATTCTTTATTCTAAATTTTAATTAATCTACTATTGGGTTCTTATAAATACTCTTATTTCGATATTGCTTATATTTAATTCCGAATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 11.80% 0.36% 0.00% NA
All Indica  2759 81.60% 17.90% 0.58% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 82.20% 17.50% 0.37% 0.00% NA
Indica I  595 58.20% 40.20% 1.68% 0.00% NA
Indica II  465 77.20% 22.60% 0.22% 0.00% NA
Indica III  913 96.30% 3.50% 0.22% 0.00% NA
Indica Intermediate  786 84.70% 14.90% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105459915 G -> A LOC_Os01g10370.1 upstream_gene_variant ; 4224.0bp to feature; MODIFIER silent_mutation Average:14.983; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0105459915 G -> A LOC_Os01g10380.1 upstream_gene_variant ; 4195.0bp to feature; MODIFIER silent_mutation Average:14.983; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0105459915 G -> A LOC_Os01g10370-LOC_Os01g10380 intergenic_region ; MODIFIER silent_mutation Average:14.983; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105459915 3.75E-06 9.80E-09 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105459915 2.39E-06 6.69E-14 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105459915 NA 4.40E-12 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105459915 NA 7.98E-12 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105459915 NA 1.16E-08 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105459915 8.87E-06 1.66E-10 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105459915 NA 8.89E-11 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105459915 NA 1.88E-08 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105459915 NA 2.27E-08 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105459915 1.30E-06 1.61E-06 mr1916_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105459915 NA 2.07E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105459915 NA 8.05E-07 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105459915 NA 2.58E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251