Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105385456:

Variant ID: vg0105385456 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5385456
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTGTCGTATCATATCGGATATACGGACACATATTTTAAGTATTAAACGCCTGTAAACTGCCAGGCGAATTTATTGAGCCTAATTAATCCATCATTAG[T/C]
AAATGTTTACTGTAGCACCACATTGTCAAATCATGGAGCAATTAGGCTTAAAAGATTCGTCTCACAATTTACACGCAATCTGTATAATTAGTTATTTTTT

Reverse complement sequence

AAAAAATAACTAATTATACAGATTGCGTGTAAATTGTGAGACGAATCTTTTAAGCCTAATTGCTCCATGATTTGACAATGTGGTGCTACAGTAAACATTT[A/G]
CTAATGATGGATTAATTAGGCTCAATAAATTCGCCTGGCAGTTTACAGGCGTTTAATACTTAAAATATGTGTCCGTATATCCGATATGATACGACAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.50%	9.40%	0.02%	0.00%	NA
All Indica	2759	99.20%	0.80%	0.04%	0.00%	NA
All Japonica	1512	73.70%	26.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.00%	0.90%	0.13%	0.00%	NA
Temperate Japonica	767	54.10%	45.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	82.20%	17.80%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105385456	T -> C	LOC_Os01g10240.1	upstream_gene_variant ; 1539.0bp to feature; MODIFIER	silent_mutation	Average:42.705; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0105385456	T -> C	LOC_Os01g10230.1	downstream_gene_variant ; 368.0bp to feature; MODIFIER	silent_mutation	Average:42.705; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0105385456	T -> C	LOC_Os01g10250.1	downstream_gene_variant ; 4277.0bp to feature; MODIFIER	silent_mutation	Average:42.705; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0105385456	T -> C	LOC_Os01g10250.2	downstream_gene_variant ; 4277.0bp to feature; MODIFIER	silent_mutation	Average:42.705; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0105385456	T -> C	LOC_Os01g10250.3	downstream_gene_variant ; 4277.0bp to feature; MODIFIER	silent_mutation	Average:42.705; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0105385456	T -> C	LOC_Os01g10230-LOC_Os01g10240	intergenic_region ; MODIFIER	silent_mutation	Average:42.705; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105385456	1.01E-08	8.57E-06	mr1460_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105385456	NA	4.09E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251