| Variant ID: vg0105385381 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5385381 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 117. )
AGTATTGTTGCTCCTGGGTAAGTTTATGTTGCTCCTACCTTTTACTTAGGCTGTGTTTGGATCAAGCGGTGAAAATTTTTGTCGTATCATATCGGATATA[C/T]
GGACACATATTTTAAGTATTAAACGCCTGTAAACTGCCAGGCGAATTTATTGAGCCTAATTAATCCATCATTAGTAAATGTTTACTGTAGCACCACATTG
CAATGTGGTGCTACAGTAAACATTTACTAATGATGGATTAATTAGGCTCAATAAATTCGCCTGGCAGTTTACAGGCGTTTAATACTTAAAATATGTGTCC[G/A]
TATATCCGATATGATACGACAAAAATTTTCACCGCTTGATCCAAACACAGCCTAAGTAAAAGGTAGGAGCAACATAAACTTACCCAGGAGCAACAATACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.40% | 44.40% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 32.70% | 67.20% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 31.60% | 67.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 3.20% | 96.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 33.80% | 66.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 57.60% | 42.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 25.30% | 74.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 35.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105385381 | C -> T | LOC_Os01g10240.1 | upstream_gene_variant ; 1614.0bp to feature; MODIFIER | silent_mutation | Average:41.103; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| vg0105385381 | C -> T | LOC_Os01g10230.1 | downstream_gene_variant ; 293.0bp to feature; MODIFIER | silent_mutation | Average:41.103; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| vg0105385381 | C -> T | LOC_Os01g10250.1 | downstream_gene_variant ; 4352.0bp to feature; MODIFIER | silent_mutation | Average:41.103; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| vg0105385381 | C -> T | LOC_Os01g10250.2 | downstream_gene_variant ; 4352.0bp to feature; MODIFIER | silent_mutation | Average:41.103; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| vg0105385381 | C -> T | LOC_Os01g10250.3 | downstream_gene_variant ; 4352.0bp to feature; MODIFIER | silent_mutation | Average:41.103; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| vg0105385381 | C -> T | LOC_Os01g10230-LOC_Os01g10240 | intergenic_region ; MODIFIER | silent_mutation | Average:41.103; most accessible tissue: Minghui63 root, score: 61.65 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105385381 | NA | 2.18E-06 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105385381 | NA | 9.83E-10 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105385381 | 4.59E-06 | 9.84E-13 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105385381 | NA | 3.50E-11 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105385381 | NA | 1.66E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105385381 | NA | 1.98E-08 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105385381 | NA | 4.08E-14 | mr1904 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105385381 | NA | 4.63E-07 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105385381 | NA | 3.48E-11 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105385381 | NA | 3.23E-09 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105385381 | NA | 1.53E-12 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105385381 | NA | 9.17E-07 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |