\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105366812:

Variant ID: vg0105366812 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5366812
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCCGTCTGTAAACTGCAAGATGAATTTATTAAGCCTAATTAATCCATCATTAGTAAATATTTAATGTAGCATCACATTCTTAAATCATGGCGCAATTA[G/T]
ACTCAAAAGATTCGTCTCGTAATTTACATGCAAACTGTGCAATTGGTTTTTATTTTTATCGACATTTAATATTTTATGTATGTGTACAGATATTCGATGT

Reverse complement sequence

ACATCGAATATCTGTACACATACATAAAATATTAAATGTCGATAAAAATAAAAACCAATTGCACAGTTTGCATGTAAATTACGAGACGAATCTTTTGAGT[C/A]
TAATTGCGCCATGATTTAAGAATGTGATGCTACATTAAATATTTACTAATGATGGATTAATTAGGCTTAATAAATTCATCTTGCAGTTTACAGACGGAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 14.30% 0.08% 0.00% NA
All Indica  2759 80.40% 19.50% 0.14% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 54.30% 45.70% 0.00% 0.00% NA
Indica I  595 50.80% 48.90% 0.34% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 97.50% 2.40% 0.11% 0.00% NA
Indica Intermediate  786 72.50% 27.40% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105366812 G -> T LOC_Os01g10195.1 upstream_gene_variant ; 4135.0bp to feature; MODIFIER silent_mutation Average:48.344; most accessible tissue: Minghui63 root, score: 79.74 N N N N
vg0105366812 G -> T LOC_Os01g10200.1 upstream_gene_variant ; 2590.0bp to feature; MODIFIER silent_mutation Average:48.344; most accessible tissue: Minghui63 root, score: 79.74 N N N N
vg0105366812 G -> T LOC_Os01g10195-LOC_Os01g10200 intergenic_region ; MODIFIER silent_mutation Average:48.344; most accessible tissue: Minghui63 root, score: 79.74 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105366812 NA 4.51E-06 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105366812 NA 5.67E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105366812 NA 1.57E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105366812 NA 6.05E-06 mr1606 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105366812 2.14E-06 2.14E-06 mr1651 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251