\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105363790:

Variant ID: vg0105363790 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5363790
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, C: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


TACATGGGCATTGAGACATGTAAATATTAATGAATCGCTTGTTTACGAGGAATGACTAGTAGCATATTTAAATGGATGATAAGTAGAATTACTTATCCTT[G/C]
TTCTGTGTGCCAAGATAAAAATATAACTATCAAAAGTAGATGGAGAGAGTATTATTCTAACACAGAACTCCCGAAGATCCTTAGAGGTGAAAATCAAGGA

Reverse complement sequence

TCCTTGATTTTCACCTCTAAGGATCTTCGGGAGTTCTGTGTTAGAATAATACTCTCTCCATCTACTTTTGATAGTTATATTTTTATCTTGGCACACAGAA[C/G]
AAGGATAAGTAATTCTACTTATCATCCATTTAAATATGCTACTAGTCATTCCTCGTAAACAAGCGATTCATTAATATTTACATGTCTCAATGCCCATGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.40% 17.60% 0.02% 0.00% NA
All Indica  2759 70.40% 29.60% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 69.90% 29.90% 0.22% 0.00% NA
Indica III  913 43.70% 56.30% 0.00% 0.00% NA
Indica Intermediate  786 81.30% 18.70% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105363790 G -> C LOC_Os01g10195.1 upstream_gene_variant ; 1113.0bp to feature; MODIFIER silent_mutation Average:56.134; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0105363790 G -> C LOC_Os01g10195-LOC_Os01g10200 intergenic_region ; MODIFIER silent_mutation Average:56.134; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105363790 2.83E-08 6.68E-16 mr1498 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 8.67E-08 7.56E-17 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 NA 1.37E-14 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 NA 5.69E-14 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 NA 8.33E-10 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 NA 2.54E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 NA 5.03E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 1.35E-07 2.99E-16 mr1951 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 1.22E-06 3.12E-14 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 4.65E-07 3.07E-14 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 2.79E-06 2.27E-11 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 1.06E-06 2.69E-13 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 7.51E-08 1.90E-16 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 NA 1.76E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 NA 5.31E-06 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 NA 2.35E-08 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105363790 NA 1.28E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251