\
| Variant ID: vg0105279447 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5279447 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTTCTTATTACACGAAAGATGTGAACACATGTGGGAGTTGGTTTCATTCCTTTCCCAATCAACCTCACTCGTTTTCATGCGTACGCATTTTTAAACTG[C/T]
TAAACGGTATGTTAAATTTTATTTACAAAAATTGCTTTTAAAAATTATATTAATATTTTTTTTAAAAAATATAACACTTAATTAGTCATGCACTAAACAT
ATGTTTAGTGCATGACTAATTAAGTGTTATATTTTTTAAAAAAAATATTAATATAATTTTTAAAAGCAATTTTTGTAAATAAAATTTAACATACCGTTTA[G/A]
CAGTTTAAAAATGCGTACGCATGAAAACGAGTGAGGTTGATTGGGAAAGGAATGAAACCAACTCCCACATGTGTTCACATCTTTCGTGTAATAAGAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.30% | 22.80% | 0.87% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 33.50% | 64.00% | 2.51% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 0.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 56.30% | 39.20% | 4.43% | 0.00% | NA |
| Tropical Japonica | 504 | 5.20% | 94.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 20.30% | 78.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 29.20% | 70.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 26.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105279447 | C -> T | LOC_Os01g10110.1 | upstream_gene_variant ; 3769.0bp to feature; MODIFIER | silent_mutation | Average:37.783; most accessible tissue: Callus, score: 84.441 | N | N | N | N |
| vg0105279447 | C -> T | LOC_Os01g10120.1 | upstream_gene_variant ; 1735.0bp to feature; MODIFIER | silent_mutation | Average:37.783; most accessible tissue: Callus, score: 84.441 | N | N | N | N |
| vg0105279447 | C -> T | LOC_Os01g10110-LOC_Os01g10120 | intergenic_region ; MODIFIER | silent_mutation | Average:37.783; most accessible tissue: Callus, score: 84.441 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105279447 | NA | 4.23E-06 | mr1187 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105279447 | 7.86E-07 | NA | mr1482 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105279447 | NA | 5.58E-10 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105279447 | NA | 5.32E-10 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105279447 | NA | 1.02E-08 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105279447 | NA | 6.39E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105279447 | 6.66E-06 | NA | mr1788 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105279447 | 6.02E-06 | NA | mr1891 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105279447 | NA | 5.34E-10 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105279447 | NA | 2.05E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105279447 | NA | 1.32E-08 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |