\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105276912:

Variant ID: vg0105276912 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5276912
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTGCTGTGTGTCTTTGTTTCCACTCCTAATCAGTGTGCGTTGTGAGTTCAAGTGCACGCGTTGCGCGATTCAGTCACGACGTCCCCATATCTCCTGCT[G/T]
TTTCCAGGACTCGACATATGTGCACTTTGGCACATCTCCTAGATGGACCGAGGAAAAACAGAAAAGACGATACGTAGAGCCTTATTATACATACGGAACT

Reverse complement sequence

AGTTCCGTATGTATAATAAGGCTCTACGTATCGTCTTTTCTGTTTTTCCTCGGTCCATCTAGGAGATGTGCCAAAGTGCACATATGTCGAGTCCTGGAAA[C/A]
AGCAGGAGATATGGGGACGTCGTGACTGAATCGCGCAACGCGTGCACTTGAACTCACAACGCACACTGATTAGGAGTGGAAACAAAGACACACAGCACCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 18.20% 0.04% 0.00% NA
All Indica  2759 69.30% 30.60% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.40% 6.40% 0.17% 0.00% NA
Indica II  465 69.00% 31.00% 0.00% 0.00% NA
Indica III  913 46.30% 53.60% 0.11% 0.00% NA
Indica Intermediate  786 78.00% 22.00% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105276912 G -> T LOC_Os01g10110.1 upstream_gene_variant ; 1234.0bp to feature; MODIFIER silent_mutation Average:53.429; most accessible tissue: Callus, score: 78.91 N N N N
vg0105276912 G -> T LOC_Os01g10120.1 upstream_gene_variant ; 4270.0bp to feature; MODIFIER silent_mutation Average:53.429; most accessible tissue: Callus, score: 78.91 N N N N
vg0105276912 G -> T LOC_Os01g10110-LOC_Os01g10120 intergenic_region ; MODIFIER silent_mutation Average:53.429; most accessible tissue: Callus, score: 78.91 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105276912 4.23E-07 4.16E-13 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105276912 1.53E-07 4.25E-14 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105276912 NA 7.04E-13 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105276912 NA 9.98E-12 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105276912 NA 5.85E-06 mr1881 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105276912 NA 8.32E-10 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105276912 NA 1.97E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105276912 1.09E-09 8.81E-16 mr1951 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105276912 5.38E-09 5.29E-14 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105276912 6.72E-06 5.57E-13 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105276912 NA 5.93E-10 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105276912 NA 4.44E-12 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105276912 2.35E-06 3.93E-14 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105276912 NA 1.13E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105276912 NA 2.00E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105276912 NA 1.32E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251