\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105240226:

Variant ID: vg0105240226 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5240226
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTACTAACACTTAGTATTGCAGAAAATAACAGAGATTCCCTCAAAGTTGCATTAGTGATTGATATATACACCTAGGCAGAAGTCAATTGAATCTCCCA[A/G]
AATAACTGGATTTGGTAGTTCTTTGAACTGGTAAATTCAGACAACATAAGCTTAAGCTGTCCAGGAAAGGAATACACACCCTTTTTTTCCCTCTATTGTG

Reverse complement sequence

CACAATAGAGGGAAAAAAAGGGTGTGTATTCCTTTCCTGGACAGCTTAAGCTTATGTTGTCTGAATTTACCAGTTCAAAGAACTACCAAATCCAGTTATT[T/C]
TGGGAGATTCAATTGACTTCTGCCTAGGTGTATATATCAATCACTAATGCAACTTTGAGGGAATCTCTGTTATTTTCTGCAATACTAAGTGTTAGTACAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.20% 47.30% 0.38% 0.06% NA
All Indica  2759 20.40% 79.00% 0.54% 0.11% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 97.80% 1.90% 0.37% 0.00% NA
Indica I  595 47.20% 51.30% 1.51% 0.00% NA
Indica II  465 3.40% 96.60% 0.00% 0.00% NA
Indica III  913 4.10% 95.70% 0.11% 0.11% NA
Indica Intermediate  786 29.00% 70.10% 0.64% 0.25% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 57.80% 40.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105240226 A -> G LOC_Os01g10040.1 intron_variant ; MODIFIER silent_mutation Average:73.419; most accessible tissue: Zhenshan97 flower, score: 81.984 N N N N
vg0105240226 A -> G LOC_Os01g10040.2 intron_variant ; MODIFIER silent_mutation Average:73.419; most accessible tissue: Zhenshan97 flower, score: 81.984 N N N N
vg0105240226 A -> DEL N N silent_mutation Average:73.419; most accessible tissue: Zhenshan97 flower, score: 81.984 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105240226 NA 1.79E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 8.82E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 6.78E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 4.15E-13 mr1316 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 4.73E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 9.55E-13 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 9.59E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 6.29E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 6.18E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 4.59E-06 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 1.38E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 7.23E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 1.01E-11 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 9.26E-07 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 1.57E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 9.24E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 1.08E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 2.99E-11 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 2.59E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 1.13E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 4.16E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 1.55E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 3.67E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 9.47E-07 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105240226 NA 1.32E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251