\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105214835:

Variant ID: vg0105214835 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5214835
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAACATACAAGAAATACATGCACACGTAAAGCATCGTATGAAGAAACAACTGACACTGAAAAGGGAAGCTGTAAATTGCCATTATGATACTGTACGAA[A/G]
TGAGATGGTAGTGGTTAGACAAACAACCAAATAGATGACAAAGTAAGGAGTACAAAATAATTTGCATTTGCAGTCAACAGTTTTAGAAATAATTTAAGAA

Reverse complement sequence

TTCTTAAATTATTTCTAAAACTGTTGACTGCAAATGCAAATTATTTTGTACTCCTTACTTTGTCATCTATTTGGTTGTTTGTCTAACCACTACCATCTCA[T/C]
TTCGTACAGTATCATAATGGCAATTTACAGCTTCCCTTTTCAGTGTCAGTTGTTTCTTCATACGATGCTTTACGTGTGCATGTATTTCTTGTATGTTTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.60% 13.20% 0.02% 0.19% NA
All Indica  2759 80.40% 19.30% 0.04% 0.29% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 68.80% 30.90% 0.00% 0.37% NA
Indica I  595 62.50% 36.50% 0.17% 0.84% NA
Indica II  465 77.80% 21.90% 0.00% 0.22% NA
Indica III  913 94.90% 5.10% 0.00% 0.00% NA
Indica Intermediate  786 78.50% 21.20% 0.00% 0.25% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105214835 A -> G LOC_Os01g10000.1 upstream_gene_variant ; 1543.0bp to feature; MODIFIER silent_mutation Average:55.192; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0105214835 A -> G LOC_Os01g10020.1 upstream_gene_variant ; 3707.0bp to feature; MODIFIER silent_mutation Average:55.192; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0105214835 A -> G LOC_Os01g10010.2 downstream_gene_variant ; 993.0bp to feature; MODIFIER silent_mutation Average:55.192; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0105214835 A -> G LOC_Os01g10010.1 intron_variant ; MODIFIER silent_mutation Average:55.192; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0105214835 A -> DEL N N silent_mutation Average:55.192; most accessible tissue: Minghui63 root, score: 74.812 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105214835 4.96E-09 4.19E-09 mr1498 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835 5.40E-08 1.25E-15 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835 NA 2.10E-09 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835 NA 3.46E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835 NA 1.13E-10 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835 8.20E-06 5.01E-11 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835 3.54E-06 2.21E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835 6.01E-06 2.87E-10 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835 NA 5.73E-12 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835 NA 1.68E-10 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835 NA 2.28E-10 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835 NA 2.45E-09 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835 NA 4.44E-08 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835 NA 1.11E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835 NA 1.90E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251