Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105214835:

Variant ID: vg0105214835 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5214835
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

GGAAACATACAAGAAATACATGCACACGTAAAGCATCGTATGAAGAAACAACTGACACTGAAAAGGGAAGCTGTAAATTGCCATTATGATACTGTACGAA[A/G]
TGAGATGGTAGTGGTTAGACAAACAACCAAATAGATGACAAAGTAAGGAGTACAAAATAATTTGCATTTGCAGTCAACAGTTTTAGAAATAATTTAAGAA

Reverse complement sequence

TTCTTAAATTATTTCTAAAACTGTTGACTGCAAATGCAAATTATTTTGTACTCCTTACTTTGTCATCTATTTGGTTGTTTGTCTAACCACTACCATCTCA[T/C]
TTCGTACAGTATCATAATGGCAATTTACAGCTTCCCTTTTCAGTGTCAGTTGTTTCTTCATACGATGCTTTACGTGTGCATGTATTTCTTGTATGTTTCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	13.20%	0.02%	0.19%	NA
All Indica	2759	80.40%	19.30%	0.04%	0.29%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	68.80%	30.90%	0.00%	0.37%	NA
Indica I	595	62.50%	36.50%	0.17%	0.84%	NA
Indica II	465	77.80%	21.90%	0.00%	0.22%	NA
Indica III	913	94.90%	5.10%	0.00%	0.00%	NA
Indica Intermediate	786	78.50%	21.20%	0.00%	0.25%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105214835	A -> G	LOC_Os01g10000.1	upstream_gene_variant ; 1543.0bp to feature; MODIFIER	silent_mutation	Average:55.192; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0105214835	A -> G	LOC_Os01g10020.1	upstream_gene_variant ; 3707.0bp to feature; MODIFIER	silent_mutation	Average:55.192; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0105214835	A -> G	LOC_Os01g10010.2	downstream_gene_variant ; 993.0bp to feature; MODIFIER	silent_mutation	Average:55.192; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0105214835	A -> G	LOC_Os01g10010.1	intron_variant ; MODIFIER	silent_mutation	Average:55.192; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0105214835	A -> DEL	N	N	silent_mutation	Average:55.192; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105214835	4.96E-09	4.19E-09	mr1498	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835	5.40E-08	1.25E-15	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835	NA	2.10E-09	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835	NA	3.46E-06	mr1795	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835	NA	1.13E-10	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835	8.20E-06	5.01E-11	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835	3.54E-06	2.21E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835	6.01E-06	2.87E-10	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835	NA	5.73E-12	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835	NA	1.68E-10	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835	NA	2.28E-10	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835	NA	2.45E-09	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835	NA	4.44E-08	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835	NA	1.11E-08	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105214835	NA	1.90E-06	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251