\
| Variant ID: vg0105205583 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5205583 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.03, A: 0.01, others allele: 0.00, population size: 122. )
ACCCACTTTTGACAATAGCGTAGTCTCAATTTGCCCGTAGTCCGTCTAGGCTCATGTGAATTATTCATCGAAATTATATATAATTAAAAAATAAAAAAAA[T/C]
TATAAATATTGTTTATACGTCATGTTTGATACAACTCCACATCTTAAATTTGCGCTGGATTTAATGTTTGTATGTTAAAGTATAGCCGTTTAAAATTTTT
AAAAATTTTAAACGGCTATACTTTAACATACAAACATTAAATCCAGCGCAAATTTAAGATGTGGAGTTGTATCAAACATGACGTATAAACAATATTTATA[A/G]
TTTTTTTTATTTTTTAATTATATATAATTTCGATGAATAATTCACATGAGCCTAGACGGACTACGGGCAAATTGAGACTACGCTATTGTCAAAAGTGGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.10% | 47.50% | 0.83% | 0.51% | NA |
| All Indica | 2759 | 78.60% | 20.80% | 0.40% | 0.18% | NA |
| All Japonica | 1512 | 1.90% | 95.40% | 1.59% | 1.19% | NA |
| Aus | 269 | 67.70% | 32.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 62.00% | 37.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 75.10% | 23.90% | 0.65% | 0.43% | NA |
| Indica III | 913 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 75.80% | 23.20% | 0.64% | 0.38% | NA |
| Temperate Japonica | 767 | 1.30% | 94.40% | 2.22% | 2.09% | NA |
| Tropical Japonica | 504 | 3.20% | 95.40% | 1.19% | 0.20% | NA |
| Japonica Intermediate | 241 | 0.80% | 98.30% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 56.70% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105205583 | T -> DEL | N | N | silent_mutation | Average:30.335; most accessible tissue: Callus, score: 53.821 | N | N | N | N |
| vg0105205583 | T -> C | LOC_Os01g09990.1 | downstream_gene_variant ; 1537.0bp to feature; MODIFIER | silent_mutation | Average:30.335; most accessible tissue: Callus, score: 53.821 | N | N | N | N |
| vg0105205583 | T -> C | LOC_Os01g10000.1 | downstream_gene_variant ; 4885.0bp to feature; MODIFIER | silent_mutation | Average:30.335; most accessible tissue: Callus, score: 53.821 | N | N | N | N |
| vg0105205583 | T -> C | LOC_Os01g09990.2 | downstream_gene_variant ; 1537.0bp to feature; MODIFIER | silent_mutation | Average:30.335; most accessible tissue: Callus, score: 53.821 | N | N | N | N |
| vg0105205583 | T -> C | LOC_Os01g09990-LOC_Os01g10000 | intergenic_region ; MODIFIER | silent_mutation | Average:30.335; most accessible tissue: Callus, score: 53.821 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105205583 | NA | 3.26E-06 | mr1100 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 5.12E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 7.87E-06 | mr1285 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 8.72E-06 | mr1372 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 3.19E-06 | mr1374 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 7.78E-06 | mr1432 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 1.90E-08 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | 1.45E-07 | 1.45E-07 | mr1445 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | 2.90E-08 | 1.48E-11 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | 6.07E-08 | 1.95E-15 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | 1.21E-06 | 1.21E-06 | mr1545 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 3.40E-06 | mr1613 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 2.51E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 6.62E-06 | mr1633 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | 3.12E-07 | 9.16E-11 | mr1769 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 2.95E-08 | mr1795 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 2.03E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 1.27E-06 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 6.37E-06 | mr1906 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 7.33E-07 | mr1909 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 4.33E-10 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | 5.77E-07 | 3.49E-08 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | 1.62E-07 | 1.25E-11 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | 8.68E-06 | 8.68E-06 | mr1972 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 1.90E-12 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 2.25E-10 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 1.96E-09 | mr1925_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 4.12E-06 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 1.72E-09 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105205583 | NA | 1.60E-06 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |