\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105205583:

Variant ID: vg0105205583 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5205583
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.03, A: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCACTTTTGACAATAGCGTAGTCTCAATTTGCCCGTAGTCCGTCTAGGCTCATGTGAATTATTCATCGAAATTATATATAATTAAAAAATAAAAAAAA[T/C]
TATAAATATTGTTTATACGTCATGTTTGATACAACTCCACATCTTAAATTTGCGCTGGATTTAATGTTTGTATGTTAAAGTATAGCCGTTTAAAATTTTT

Reverse complement sequence

AAAAATTTTAAACGGCTATACTTTAACATACAAACATTAAATCCAGCGCAAATTTAAGATGTGGAGTTGTATCAAACATGACGTATAAACAATATTTATA[A/G]
TTTTTTTTATTTTTTAATTATATATAATTTCGATGAATAATTCACATGAGCCTAGACGGACTACGGGCAAATTGAGACTACGCTATTGTCAAAAGTGGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 47.50% 0.83% 0.51% NA
All Indica  2759 78.60% 20.80% 0.40% 0.18% NA
All Japonica  1512 1.90% 95.40% 1.59% 1.19% NA
Aus  269 67.70% 32.00% 0.37% 0.00% NA
Indica I  595 62.00% 37.50% 0.50% 0.00% NA
Indica II  465 75.10% 23.90% 0.65% 0.43% NA
Indica III  913 93.60% 6.40% 0.00% 0.00% NA
Indica Intermediate  786 75.80% 23.20% 0.64% 0.38% NA
Temperate Japonica  767 1.30% 94.40% 2.22% 2.09% NA
Tropical Japonica  504 3.20% 95.40% 1.19% 0.20% NA
Japonica Intermediate  241 0.80% 98.30% 0.41% 0.41% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 38.90% 56.70% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105205583 T -> DEL N N silent_mutation Average:30.335; most accessible tissue: Callus, score: 53.821 N N N N
vg0105205583 T -> C LOC_Os01g09990.1 downstream_gene_variant ; 1537.0bp to feature; MODIFIER silent_mutation Average:30.335; most accessible tissue: Callus, score: 53.821 N N N N
vg0105205583 T -> C LOC_Os01g10000.1 downstream_gene_variant ; 4885.0bp to feature; MODIFIER silent_mutation Average:30.335; most accessible tissue: Callus, score: 53.821 N N N N
vg0105205583 T -> C LOC_Os01g09990.2 downstream_gene_variant ; 1537.0bp to feature; MODIFIER silent_mutation Average:30.335; most accessible tissue: Callus, score: 53.821 N N N N
vg0105205583 T -> C LOC_Os01g09990-LOC_Os01g10000 intergenic_region ; MODIFIER silent_mutation Average:30.335; most accessible tissue: Callus, score: 53.821 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105205583 NA 3.26E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 5.12E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 7.87E-06 mr1285 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 8.72E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 3.19E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 7.78E-06 mr1432 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 1.90E-08 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 1.45E-07 1.45E-07 mr1445 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 2.90E-08 1.48E-11 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 6.07E-08 1.95E-15 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 1.21E-06 1.21E-06 mr1545 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 3.40E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 2.51E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 6.62E-06 mr1633 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 3.12E-07 9.16E-11 mr1769 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 2.95E-08 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 2.03E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 1.27E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 6.37E-06 mr1906 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 7.33E-07 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 4.33E-10 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 5.77E-07 3.49E-08 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 1.62E-07 1.25E-11 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 8.68E-06 8.68E-06 mr1972 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 1.90E-12 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 2.25E-10 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 1.96E-09 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 4.12E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 1.72E-09 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205583 NA 1.60E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251