\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105188247:

Variant ID: vg0105188247 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5188247
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.03, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


GTCGGACGGCTAATGGTAAGCATTATCGGAAAGAAGAAGTACACGGTGTGCCCACATAGAATAGGATGGCTCATTATCTTGATGAAGCAACGCAAAAAGT[A/T]
TCGAACGACAGCCACAGAACTGATCACATTGCCAGGAAAAATATAAGTATGTAAACAAGCATTAGAGCATGTTGAAAAACATTAAAAATATATTTTTAAA

Reverse complement sequence

TTTAAAAATATATTTTTAATGTTTTTCAACATGCTCTAATGCTTGTTTACATACTTATATTTTTCCTGGCAATGTGATCAGTTCTGTGGCTGTCGTTCGA[T/A]
ACTTTTTGCGTTGCTTCATCAAGATAATGAGCCATCCTATTCTATGTGGGCACACCGTGTACTTCTTCTTTCCGATAATGCTTACCATTAGCCGTCCGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 48.80% 0.17% 0.25% NA
All Indica  2759 20.90% 78.50% 0.18% 0.43% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 66.90% 32.30% 0.74% 0.00% NA
Indica I  595 53.80% 45.40% 0.00% 0.84% NA
Indica II  465 3.00% 96.30% 0.43% 0.22% NA
Indica III  913 3.20% 96.60% 0.11% 0.11% NA
Indica Intermediate  786 27.10% 72.00% 0.25% 0.64% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 56.70% 42.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105188247 A -> T LOC_Os01g09970.1 upstream_gene_variant ; 2680.0bp to feature; MODIFIER silent_mutation Average:36.284; most accessible tissue: Callus, score: 72.059 N N N N
vg0105188247 A -> T LOC_Os01g09960.1 downstream_gene_variant ; 4633.0bp to feature; MODIFIER silent_mutation Average:36.284; most accessible tissue: Callus, score: 72.059 N N N N
vg0105188247 A -> T LOC_Os01g09960-LOC_Os01g09970 intergenic_region ; MODIFIER silent_mutation Average:36.284; most accessible tissue: Callus, score: 72.059 N N N N
vg0105188247 A -> DEL N N silent_mutation Average:36.284; most accessible tissue: Callus, score: 72.059 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105188247 NA 3.63E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105188247 NA 6.84E-12 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105188247 NA 8.07E-06 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105188247 NA 5.61E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105188247 NA 7.77E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105188247 NA 3.66E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105188247 NA 5.36E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105188247 NA 4.53E-13 mr1663 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105188247 NA 6.62E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105188247 NA 3.62E-06 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105188247 7.63E-06 NA mr1895 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105188247 NA 3.89E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105188247 9.81E-06 1.19E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105188247 NA 9.95E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251