\
| Variant ID: vg0105186659 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5186659 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGGATCGGACGTCCGATCAGGAGAAAAAAATCGGACGCTCGTCCCAGCCATCGGATCGAGGGATTAAATCTCGACCATTGATAGCGCGTCGTCACTGTTC[G/A]
ATGCAAACTTCTCCCGGGCAGCTGCATGCATGCAACTTTTCCCGCGCACAGAATTGCATATGTGACAGGGATAGTTAATGTTTTGTAAGCAAACTTTAAA
TTTAAAGTTTGCTTACAAAACATTAACTATCCCTGTCACATATGCAATTCTGTGCGCGGGAAAAGTTGCATGCATGCAGCTGCCCGGGAGAAGTTTGCAT[C/T]
GAACAGTGACGACGCGCTATCAATGGTCGAGATTTAATCCCTCGATCCGATGGCTGGGACGAGCGTCCGATTTTTTTCTCCTGATCGGACGTCCGATCCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.50% | 14.20% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 80.40% | 19.20% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 53.90% | 46.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 46.90% | 52.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 97.70% | 2.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 75.30% | 24.00% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105186659 | G -> A | LOC_Os01g09970.1 | upstream_gene_variant ; 4268.0bp to feature; MODIFIER | silent_mutation | Average:20.681; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0105186659 | G -> A | LOC_Os01g09960.1 | downstream_gene_variant ; 3045.0bp to feature; MODIFIER | silent_mutation | Average:20.681; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0105186659 | G -> A | LOC_Os01g09960-LOC_Os01g09970 | intergenic_region ; MODIFIER | silent_mutation | Average:20.681; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105186659 | NA | 6.14E-06 | mr1166 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105186659 | 1.75E-06 | NA | mr1210 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105186659 | NA | 8.71E-06 | mr1316 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105186659 | NA | 4.92E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105186659 | NA | 7.14E-07 | mr1485 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105186659 | NA | 1.36E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105186659 | NA | 7.98E-06 | mr1511 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105186659 | NA | 4.21E-07 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105186659 | 3.42E-06 | 3.42E-06 | mr1651 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105186659 | NA | 6.03E-07 | mr1805_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |