\
| Variant ID: vg0105180474 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5180474 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 241. )
GAGGAATGCCAGTGTTCAACGCTCCTGCGTTGACAGCACTTGTGGACAGATGGAGGCCTGAGACACATAGCTTCCACCTCCCCAGTGGTGAGATGACTAT[C/T]
ACTCTACAGGATGTGGCTATGATCTTGGCCCTCCCATTACGGGGGCATGCCGTGACGGGCAGGACAGAGACTCCTGGATGGCGTGCACAAGTGGAGCAGC
GCTGCTCCACTTGTGCACGCCATCCAGGAGTCTCTGTCCTGCCCGTCACGGCATGCCCCCGTAATGGGAGGGCCAAGATCATAGCCACATCCTGTAGAGT[G/A]
ATAGTCATCTCACCACTGGGGAGGTGGAAGCTATGTGTCTCAGGCCTCCATCTGTCCACAAGTGCTGTCAACGCAGGAGCGTTGAACACTGGCATTCCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.70% | 48.90% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 20.80% | 78.50% | 0.65% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 66.90% | 32.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 53.60% | 45.40% | 1.01% | 0.00% | NA |
| Indica II | 465 | 3.00% | 96.10% | 0.86% | 0.00% | NA |
| Indica III | 913 | 3.10% | 96.70% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 27.20% | 72.00% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 43.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105180474 | C -> T | LOC_Os01g09960.1 | intron_variant ; MODIFIER | silent_mutation | Average:35.13; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105180474 | NA | 9.61E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | NA | 2.11E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | NA | 9.94E-14 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | NA | 5.38E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | NA | 4.50E-11 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | NA | 1.44E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | NA | 6.17E-06 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | NA | 2.16E-09 | mr1379 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | NA | 2.31E-06 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | NA | 5.02E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | NA | 2.10E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | NA | 3.36E-13 | mr1663 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | NA | 3.33E-11 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | NA | 7.32E-06 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | 4.60E-06 | NA | mr1895 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | NA | 9.02E-06 | mr1908 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105180474 | NA | 2.42E-14 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |