\
| Variant ID: vg0105172050 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5172050 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTGTAGTCTTAGTTTTTCGATCGAGACTACGAATGCAGGACTAAAAATCGCTATCTTTAGTCCCGGTTCAAATACCCGGTACTAAAGATCGATTTTTAGT[C/T]
CCGGTTAGTAACACCAACCGAGATTAAAAATAAAGTCATTTACCAACCGGGACTAAAGATGAAGTCAGATCTGATTGGTAGTTTCTCTTTTCTTGTATTG
CAATACAAGAAAAGAGAAACTACCAATCAGATCTGACTTCATCTTTAGTCCCGGTTGGTAAATGACTTTATTTTTAATCTCGGTTGGTGTTACTAACCGG[G/A]
ACTAAAAATCGATCTTTAGTACCGGGTATTTGAACCGGGACTAAAGATAGCGATTTTTAGTCCTGCATTCGTAGTCTCGATCGAAAAACTAAGACTACAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.80% | 3.70% | 1.44% | 0.00% | NA |
| All Indica | 2759 | 92.40% | 5.50% | 2.14% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 91.80% | 5.60% | 2.60% | 0.00% | NA |
| Indica I | 595 | 89.10% | 5.40% | 5.55% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.90% | 1.90% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 84.50% | 12.50% | 3.05% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105172050 | C -> T | LOC_Os01g09960.1 | upstream_gene_variant ; 4196.0bp to feature; MODIFIER | silent_mutation | Average:43.666; most accessible tissue: Callus, score: 65.793 | N | N | N | N |
| vg0105172050 | C -> T | LOC_Os01g09930.1 | downstream_gene_variant ; 3626.0bp to feature; MODIFIER | silent_mutation | Average:43.666; most accessible tissue: Callus, score: 65.793 | N | N | N | N |
| vg0105172050 | C -> T | LOC_Os01g09940.1 | downstream_gene_variant ; 236.0bp to feature; MODIFIER | silent_mutation | Average:43.666; most accessible tissue: Callus, score: 65.793 | N | N | N | N |
| vg0105172050 | C -> T | LOC_Os01g09950.1 | downstream_gene_variant ; 1505.0bp to feature; MODIFIER | silent_mutation | Average:43.666; most accessible tissue: Callus, score: 65.793 | N | N | N | N |
| vg0105172050 | C -> T | LOC_Os01g09940-LOC_Os01g09950 | intergenic_region ; MODIFIER | silent_mutation | Average:43.666; most accessible tissue: Callus, score: 65.793 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105172050 | NA | 1.29E-06 | mr1166 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105172050 | 4.86E-06 | 4.86E-06 | mr1485 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105172050 | NA | 2.72E-06 | mr1727 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105172050 | NA | 1.12E-07 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105172050 | NA | 2.86E-06 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |