\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105172050:

Variant ID: vg0105172050 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5172050
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGTAGTCTTAGTTTTTCGATCGAGACTACGAATGCAGGACTAAAAATCGCTATCTTTAGTCCCGGTTCAAATACCCGGTACTAAAGATCGATTTTTAGT[C/T]
CCGGTTAGTAACACCAACCGAGATTAAAAATAAAGTCATTTACCAACCGGGACTAAAGATGAAGTCAGATCTGATTGGTAGTTTCTCTTTTCTTGTATTG

Reverse complement sequence

CAATACAAGAAAAGAGAAACTACCAATCAGATCTGACTTCATCTTTAGTCCCGGTTGGTAAATGACTTTATTTTTAATCTCGGTTGGTGTTACTAACCGG[G/A]
ACTAAAAATCGATCTTTAGTACCGGGTATTTGAACCGGGACTAAAGATAGCGATTTTTAGTCCTGCATTCGTAGTCTCGATCGAAAAACTAAGACTACAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 3.70% 1.44% 0.00% NA
All Indica  2759 92.40% 5.50% 2.14% 0.00% NA
All Japonica  1512 99.30% 0.50% 0.13% 0.00% NA
Aus  269 91.80% 5.60% 2.60% 0.00% NA
Indica I  595 89.10% 5.40% 5.55% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 97.90% 1.90% 0.22% 0.00% NA
Indica Intermediate  786 84.50% 12.50% 3.05% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 98.40% 1.40% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105172050 C -> T LOC_Os01g09960.1 upstream_gene_variant ; 4196.0bp to feature; MODIFIER silent_mutation Average:43.666; most accessible tissue: Callus, score: 65.793 N N N N
vg0105172050 C -> T LOC_Os01g09930.1 downstream_gene_variant ; 3626.0bp to feature; MODIFIER silent_mutation Average:43.666; most accessible tissue: Callus, score: 65.793 N N N N
vg0105172050 C -> T LOC_Os01g09940.1 downstream_gene_variant ; 236.0bp to feature; MODIFIER silent_mutation Average:43.666; most accessible tissue: Callus, score: 65.793 N N N N
vg0105172050 C -> T LOC_Os01g09950.1 downstream_gene_variant ; 1505.0bp to feature; MODIFIER silent_mutation Average:43.666; most accessible tissue: Callus, score: 65.793 N N N N
vg0105172050 C -> T LOC_Os01g09940-LOC_Os01g09950 intergenic_region ; MODIFIER silent_mutation Average:43.666; most accessible tissue: Callus, score: 65.793 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105172050 NA 1.29E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105172050 4.86E-06 4.86E-06 mr1485 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105172050 NA 2.72E-06 mr1727 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105172050 NA 1.12E-07 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105172050 NA 2.86E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251