\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105170616:

Variant ID: vg0105170616 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5170616
Reference Allele: AAlternative Allele: G,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GGGCGTCACGGTCAGCGGCGTCATCTTCCTGTCGGAGCTCCACCAGACGGCGGCGACACATTTTTTTATTTTAAAGATTATAGCTAGGTGCCAGTTCTAT[A/G,C]
GATAGAGGCCCCGTTTACTTTGCCAAATGAAAATTTTGGGTGGTAATATCGGATGTTTAACCGGATGTCAAAAAAAGGTTTTTGAATATGAATGAAAAAA

Reverse complement sequence

TTTTTTCATTCATATTCAAAAACCTTTTTTTGACATCCGGTTAAACATCCGATATTACCACCCAAAATTTTCATTTGGCAAAGTAAACGGGGCCTCTATC[T/C,G]
ATAGAACTGGCACCTAGCTATAATCTTTAAAATAAAAAAATGTGTCGCCGCCGTCTGGTGGAGCTCCGACAGGAAGATGACGCCGCTGACCGTGACGCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 48.90% 0.19% 0.32% C: 0.02%
All Indica  2759 20.50% 78.70% 0.25% 0.51% C: 0.04%
All Japonica  1512 98.90% 1.10% 0.07% 0.00% NA
Aus  269 67.30% 32.30% 0.00% 0.37% NA
Indica I  595 53.30% 45.50% 0.50% 0.67% NA
Indica II  465 3.70% 95.90% 0.00% 0.43% NA
Indica III  913 3.00% 96.70% 0.11% 0.22% NA
Indica Intermediate  786 26.10% 72.60% 0.38% 0.76% C: 0.13%
Temperate Japonica  767 98.70% 1.20% 0.13% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 56.70% 42.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105170616 A -> G LOC_Os01g09940.1 upstream_gene_variant ; 611.0bp to feature; MODIFIER silent_mutation Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 N N N N
vg0105170616 A -> G LOC_Os01g09930.1 downstream_gene_variant ; 2192.0bp to feature; MODIFIER silent_mutation Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 N N N N
vg0105170616 A -> G LOC_Os01g09950.1 downstream_gene_variant ; 2939.0bp to feature; MODIFIER silent_mutation Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 N N N N
vg0105170616 A -> G LOC_Os01g09930-LOC_Os01g09940 intergenic_region ; MODIFIER silent_mutation Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 N N N N
vg0105170616 A -> DEL N N silent_mutation Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 N N N N
vg0105170616 A -> C LOC_Os01g09940.1 upstream_gene_variant ; 611.0bp to feature; MODIFIER silent_mutation Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 N N N N
vg0105170616 A -> C LOC_Os01g09930.1 downstream_gene_variant ; 2192.0bp to feature; MODIFIER silent_mutation Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 N N N N
vg0105170616 A -> C LOC_Os01g09950.1 downstream_gene_variant ; 2939.0bp to feature; MODIFIER silent_mutation Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 N N N N
vg0105170616 A -> C LOC_Os01g09930-LOC_Os01g09940 intergenic_region ; MODIFIER silent_mutation Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105170616 NA 2.37E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105170616 NA 6.92E-12 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105170616 NA 9.48E-06 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105170616 NA 5.54E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105170616 NA 1.21E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105170616 NA 6.68E-13 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105170616 NA 3.43E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105170616 NA 3.31E-06 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105170616 4.55E-06 6.09E-15 mr1982 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105170616 NA 7.50E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251