\
| Variant ID: vg0105170616 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5170616 |
| Reference Allele: A | Alternative Allele: G,C |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 117. )
GGGCGTCACGGTCAGCGGCGTCATCTTCCTGTCGGAGCTCCACCAGACGGCGGCGACACATTTTTTTATTTTAAAGATTATAGCTAGGTGCCAGTTCTAT[A/G,C]
GATAGAGGCCCCGTTTACTTTGCCAAATGAAAATTTTGGGTGGTAATATCGGATGTTTAACCGGATGTCAAAAAAAGGTTTTTGAATATGAATGAAAAAA
TTTTTTCATTCATATTCAAAAACCTTTTTTTGACATCCGGTTAAACATCCGATATTACCACCCAAAATTTTCATTTGGCAAAGTAAACGGGGCCTCTATC[T/C,G]
ATAGAACTGGCACCTAGCTATAATCTTTAAAATAAAAAAATGTGTCGCCGCCGTCTGGTGGAGCTCCGACAGGAAGATGACGCCGCTGACCGTGACGCCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.50% | 48.90% | 0.19% | 0.32% | C: 0.02% |
| All Indica | 2759 | 20.50% | 78.70% | 0.25% | 0.51% | C: 0.04% |
| All Japonica | 1512 | 98.90% | 1.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 67.30% | 32.30% | 0.00% | 0.37% | NA |
| Indica I | 595 | 53.30% | 45.50% | 0.50% | 0.67% | NA |
| Indica II | 465 | 3.70% | 95.90% | 0.00% | 0.43% | NA |
| Indica III | 913 | 3.00% | 96.70% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 26.10% | 72.60% | 0.38% | 0.76% | C: 0.13% |
| Temperate Japonica | 767 | 98.70% | 1.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 42.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105170616 | A -> G | LOC_Os01g09940.1 | upstream_gene_variant ; 611.0bp to feature; MODIFIER | silent_mutation | Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 | N | N | N | N |
| vg0105170616 | A -> G | LOC_Os01g09930.1 | downstream_gene_variant ; 2192.0bp to feature; MODIFIER | silent_mutation | Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 | N | N | N | N |
| vg0105170616 | A -> G | LOC_Os01g09950.1 | downstream_gene_variant ; 2939.0bp to feature; MODIFIER | silent_mutation | Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 | N | N | N | N |
| vg0105170616 | A -> G | LOC_Os01g09930-LOC_Os01g09940 | intergenic_region ; MODIFIER | silent_mutation | Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 | N | N | N | N |
| vg0105170616 | A -> DEL | N | N | silent_mutation | Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 | N | N | N | N |
| vg0105170616 | A -> C | LOC_Os01g09940.1 | upstream_gene_variant ; 611.0bp to feature; MODIFIER | silent_mutation | Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 | N | N | N | N |
| vg0105170616 | A -> C | LOC_Os01g09930.1 | downstream_gene_variant ; 2192.0bp to feature; MODIFIER | silent_mutation | Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 | N | N | N | N |
| vg0105170616 | A -> C | LOC_Os01g09950.1 | downstream_gene_variant ; 2939.0bp to feature; MODIFIER | silent_mutation | Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 | N | N | N | N |
| vg0105170616 | A -> C | LOC_Os01g09930-LOC_Os01g09940 | intergenic_region ; MODIFIER | silent_mutation | Average:60.675; most accessible tissue: Zhenshan97 root, score: 86.891 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105170616 | NA | 2.37E-13 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105170616 | NA | 6.92E-12 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105170616 | NA | 9.48E-06 | mr1316 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105170616 | NA | 5.54E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105170616 | NA | 1.21E-08 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105170616 | NA | 6.68E-13 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105170616 | NA | 3.43E-11 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105170616 | NA | 3.31E-06 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105170616 | 4.55E-06 | 6.09E-15 | mr1982 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105170616 | NA | 7.50E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |