\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105168999:

Variant ID: vg0105168999 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5168999
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGCGTTCAGCCAATACGCACTACTACAACACTTCTAATAATTATCGGTTTATAGGTGTTGGTTCATTTAAGAGAATTTTACGGTACAATATATATACTA[A/G]
TAGTATATACTAACATTATAAATGAGGACACATTTGGAATTCCCTGCCAAATTTAAAGGGGTATTTAGTAATTCGTGATTCATCTTCATTCTAATTGTCA

Reverse complement sequence

TGACAATTAGAATGAAGATGAATCACGAATTACTAAATACCCCTTTAAATTTGGCAGGGAATTCCAAATGTGTCCTCATTTATAATGTTAGTATATACTA[T/C]
TAGTATATATATTGTACCGTAAAATTCTCTTAAATGAACCAACACCTATAAACCGATAATTATTAGAAGTGTTGTAGTAGTGCGTATTGGCTGAACGCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.80% 27.10% 0.13% 0.00% NA
All Indica  2759 99.10% 0.90% 0.04% 0.00% NA
All Japonica  1512 24.20% 75.50% 0.33% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 16.90% 82.40% 0.65% 0.00% NA
Tropical Japonica  504 37.90% 62.10% 0.00% 0.00% NA
Japonica Intermediate  241 18.70% 81.30% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 58.90% 41.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105168999 A -> G LOC_Os01g09940.1 upstream_gene_variant ; 2228.0bp to feature; MODIFIER silent_mutation Average:60.393; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0105168999 A -> G LOC_Os01g09930.1 downstream_gene_variant ; 575.0bp to feature; MODIFIER silent_mutation Average:60.393; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0105168999 A -> G LOC_Os01g09950.1 downstream_gene_variant ; 4556.0bp to feature; MODIFIER silent_mutation Average:60.393; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0105168999 A -> G LOC_Os01g09930-LOC_Os01g09940 intergenic_region ; MODIFIER silent_mutation Average:60.393; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105168999 4.64E-22 5.66E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 1.73E-14 5.94E-19 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 1.04E-06 8.23E-30 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 5.31E-06 1.14E-31 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 NA 3.39E-18 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 NA 3.23E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 NA 8.49E-06 mr1677 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 NA 3.12E-26 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 5.00E-07 7.44E-18 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 NA 5.52E-12 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 1.99E-23 NA mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 4.86E-17 1.08E-20 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 2.90E-08 2.11E-34 mr1238_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 NA 1.84E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 2.00E-07 3.02E-30 mr1484_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 7.15E-08 8.64E-38 mr1841_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 4.02E-07 3.30E-25 mr1900_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999 9.05E-07 5.41E-23 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251