Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105168999:

Variant ID: vg0105168999 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5168999
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCGCGTTCAGCCAATACGCACTACTACAACACTTCTAATAATTATCGGTTTATAGGTGTTGGTTCATTTAAGAGAATTTTACGGTACAATATATATACTA[A/G]
TAGTATATACTAACATTATAAATGAGGACACATTTGGAATTCCCTGCCAAATTTAAAGGGGTATTTAGTAATTCGTGATTCATCTTCATTCTAATTGTCA

Reverse complement sequence

TGACAATTAGAATGAAGATGAATCACGAATTACTAAATACCCCTTTAAATTTGGCAGGGAATTCCAAATGTGTCCTCATTTATAATGTTAGTATATACTA[T/C]
TAGTATATATATTGTACCGTAAAATTCTCTTAAATGAACCAACACCTATAAACCGATAATTATTAGAAGTGTTGTAGTAGTGCGTATTGGCTGAACGCGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.80%	27.10%	0.13%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.04%	0.00%	NA
All Japonica	1512	24.20%	75.50%	0.33%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	1.30%	0.00%	0.00%	NA
Temperate Japonica	767	16.90%	82.40%	0.65%	0.00%	NA
Tropical Japonica	504	37.90%	62.10%	0.00%	0.00%	NA
Japonica Intermediate	241	18.70%	81.30%	0.00%	0.00%	NA
VI/Aromatic	96	20.80%	79.20%	0.00%	0.00%	NA
Intermediate	90	58.90%	41.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105168999	A -> G	LOC_Os01g09940.1	upstream_gene_variant ; 2228.0bp to feature; MODIFIER	silent_mutation	Average:60.393; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0105168999	A -> G	LOC_Os01g09930.1	downstream_gene_variant ; 575.0bp to feature; MODIFIER	silent_mutation	Average:60.393; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0105168999	A -> G	LOC_Os01g09950.1	downstream_gene_variant ; 4556.0bp to feature; MODIFIER	silent_mutation	Average:60.393; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0105168999	A -> G	LOC_Os01g09930-LOC_Os01g09940	intergenic_region ; MODIFIER	silent_mutation	Average:60.393; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105168999	4.64E-22	5.66E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	1.73E-14	5.94E-19	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	1.04E-06	8.23E-30	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	5.31E-06	1.14E-31	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	NA	3.39E-18	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	NA	3.23E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	NA	8.49E-06	mr1677	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	NA	3.12E-26	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	5.00E-07	7.44E-18	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	NA	5.52E-12	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	1.99E-23	NA	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	4.86E-17	1.08E-20	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	2.90E-08	2.11E-34	mr1238_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	NA	1.84E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	2.00E-07	3.02E-30	mr1484_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	7.15E-08	8.64E-38	mr1841_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	4.02E-07	3.30E-25	mr1900_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105168999	9.05E-07	5.41E-23	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251