\
| Variant ID: vg0105166793 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5166793 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAAGGCGAGACGGCGGCGGCGGAAGCCGGCGACGAGACGAAGCGAGAGGACCTAGTAGAGATCGAGGTGACGACGACGAGCGGCGGCAGCGGAGCGGCGG[C/A]
TGCGGCGGCGACAGGAGGAGATCAAGAGACTTGTTGCACGCTCAACGTGGACTTGCGCGGCGGCGGCGGCGGAGGCATGAGCACGACGGACGTTGTGCTC
GAGCACAACGTCCGTCGTGCTCATGCCTCCGCCGCCGCCGCCGCGCAAGTCCACGTTGAGCGTGCAACAAGTCTCTTGATCTCCTCCTGTCGCCGCCGCA[G/T]
CCGCCGCTCCGCTGCCGCCGCTCGTCGTCGTCACCTCGATCTCTACTAGGTCCTCTCGCTTCGTCTCGTCGCCGGCTTCCGCCGCCGCCGTCTCGCCTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.40% | 27.40% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 0.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 23.60% | 76.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 15.90% | 84.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 37.50% | 62.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 19.10% | 80.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 19.80% | 79.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 42.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105166793 | C -> A | LOC_Os01g09930.1 | missense_variant ; p.Ala290Asp; MODERATE | nonsynonymous_codon ; A290D | Average:63.111; most accessible tissue: Zhenshan97 root, score: 82.361 | unknown | unknown | TOLERATED | 0.58 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105166793 | 2.31E-22 | 5.02E-07 | mr1057 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | 1.73E-14 | 5.94E-19 | mr1057 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | 1.33E-06 | 8.69E-30 | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | 8.07E-06 | 1.77E-31 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | NA | 4.28E-18 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | NA | 1.50E-07 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | NA | 8.49E-06 | mr1677 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | NA | 8.38E-26 | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | 1.42E-06 | 1.64E-17 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | NA | 1.06E-11 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | 1.52E-24 | 7.97E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | 4.86E-17 | 1.08E-20 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | 1.40E-07 | 9.51E-34 | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | NA | 1.13E-07 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | 8.62E-07 | 1.57E-29 | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | 4.32E-07 | 7.09E-37 | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | 1.44E-06 | 7.31E-25 | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166793 | 1.73E-06 | 9.91E-23 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |