\
| Variant ID: vg0105166660 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5166660 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GAAAGACAAGGCGTCGATACTGATCAGGGCAAGAGAGCACATAAAGTCTCTCGAGTCAAAGCTGTCGGAGCTGGAGGAGAAGAACCGGGAGCTGGAGGCG[A/C]
GGCTAGCCAGCCGCCCCGCCGCCAAGAACGACAAAGGCGAGACGGCGGCGGCGGAAGCCGGCGACGAGACGAAGCGAGAGGACCTAGTAGAGATCGAGGT
ACCTCGATCTCTACTAGGTCCTCTCGCTTCGTCTCGTCGCCGGCTTCCGCCGCCGCCGTCTCGCCTTTGTCGTTCTTGGCGGCGGGGCGGCTGGCTAGCC[T/G]
CGCCTCCAGCTCCCGGTTCTTCTCCTCCAGCTCCGACAGCTTTGACTCGAGAGACTTTATGTGCTCTCTTGCCCTGATCAGTATCGACGCCTTGTCTTTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.60% | 7.30% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 78.30% | 21.60% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 85.10% | 14.60% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 66.10% | 33.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105166660 | A -> C | LOC_Os01g09930.1 | synonymous_variant ; p.Arg246Arg; LOW | synonymous_codon | Average:58.877; most accessible tissue: Zhenshan97 root, score: 83.426 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105166660 | 1.78E-24 | 1.48E-26 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166660 | 1.19E-14 | 1.36E-20 | mr1057 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166660 | 2.76E-06 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166660 | 9.87E-06 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166660 | 1.67E-06 | NA | mr1677 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166660 | NA | 2.93E-06 | mr1677 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166660 | 2.05E-33 | 1.13E-38 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166660 | 2.81E-18 | 1.41E-23 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166660 | 6.70E-07 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166660 | 6.53E-06 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105166660 | 6.96E-07 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |