Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0105166176:

Variant ID: vg0105166176 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 5166176
Reference Allele: GAlternative Allele: GCACGTATCGCACTGGCACATT,T
Primary Allele: GSecondary Allele: GCACGTATCGCACTGGCACA TT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGCTGCTTGCTCAGTTGGTGGAGTGCATGTTGTGGCATCCCGACGTCATGGGTTTGATTCCCTTTTCTAGCGACTTTTTTTTTTCACTCAATGGCACAT[G/GCACGTATCGCACTGGCACATT,T]
CACGTATCTCAAAGTAAATCATGCGGTCAACAAATCGACTGATTTTTAATAGAAAATCTGTCGACAGATACGTAGCAATTCCATAATATGGGTTATTGTT

Reverse complement sequence

AACAATAACCCATATTATGGAATTGCTACGTATCTGTCGACAGATTTTCTATTAAAAATCAGTCGATTTGTTGACCGCATGATTTACTTTGAGATACGTG[C/AATGTGCCAGTGCGATACGTGC,A]
ATGTGCCATTGAGTGAAAAAAAAAAGTCGCTAGAAAAGGGAATCAAACCCATGACGTCGGGATGCCACAACATGCACTCCACCAACTGAGCAAGCAGCGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of GCACGTATCGCACTGGCACA TT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.20% 13.30% 0.38% 0.00% T: 0.08%
All Indica  2759 81.40% 17.90% 0.54% 0.00% T: 0.11%
All Japonica  1512 99.10% 0.80% 0.07% 0.00% NA
Aus  269 56.50% 42.80% 0.37% 0.00% T: 0.37%
Indica I  595 48.20% 49.90% 1.68% 0.00% T: 0.17%
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 97.90% 2.10% 0.00% 0.00% NA
Indica Intermediate  786 77.10% 22.00% 0.64% 0.00% T: 0.25%
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105166176 G -> T LOC_Os01g09930.1 intron_variant ; MODIFIER silent_mutation Average:53.667; most accessible tissue: Callus, score: 90.367 N N N N
vg0105166176 G -> GCACGTATCGCACTGGCACATT LOC_Os01g09930.1 intron_variant ; MODIFIER silent_mutation Average:53.667; most accessible tissue: Callus, score: 90.367 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0105166176 G GCACG* 0.51 0.11 0.11 0.18 0.2 0.18
vg0105166176 G T -0.28 -0.03 -0.03 -0.06 -0.12 -0.14

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105166176 4.58E-07 6.62E-06 mr1343 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251