\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105163864:

Variant ID: vg0105163864 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5163864
Reference Allele: AAlternative Allele: T,G
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTTCCTCGTCGGCGCACCACGCCGGTGCCGGCAGCTTCCAGTACTCCTCGTCGACGACGTCCTCCTCCGCCTCCTTCCGCTCCGCCTCCGTCTCGTGCA[A/T,G]
CCCGGAGAGCTCGGCGGCGGCGGCGCCAGAGTTGCCGGCGGCAACCGGCGGCGCGTTCAGTCGCTACGCGCGGCACCTCCGCCCGAGGAGGCCACCCAAG

Reverse complement sequence

CTTGGGTGGCCTCCTCGGGCGGAGGTGCCGCGCGTAGCGACTGAACGCGCCGCCGGTTGCCGCCGGCAACTCTGGCGCCGCCGCCGCCGAGCTCTCCGGG[T/A,C]
TGCACGAGACGGAGGCGGAGCGGAAGGAGGCGGAGGAGGACGTCGTCGACGAGGAGTACTGGAAGCTGCCGGCACCGGCGTGGTGCGCCGACGAGGAAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 27.50% 0.40% 7.00% G: 0.08%
All Indica  2759 98.80% 0.90% 0.14% 0.07% NA
All Japonica  1512 2.00% 76.50% 0.79% 20.63% G: 0.07%
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 98.10% 1.50% 0.22% 0.22% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.30% 0.25% 0.13% NA
Temperate Japonica  767 1.30% 83.80% 0.26% 14.60% NA
Tropical Japonica  504 3.60% 63.10% 1.79% 31.35% G: 0.20%
Japonica Intermediate  241 0.80% 81.30% 0.41% 17.43% NA
VI/Aromatic  96 4.20% 79.20% 2.08% 14.58% NA
Intermediate  90 48.90% 43.30% 1.11% 3.33% G: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105163864 A -> G LOC_Os01g09930.1 missense_variant ; p.Asn98Ser; MODERATE nonsynonymous_codon Average:72.984; most accessible tissue: Zhenshan97 panicle, score: 84.824 unknown unknown TOLERATED 1.00
vg0105163864 A -> T LOC_Os01g09930.1 missense_variant ; p.Asn98Ile; MODERATE nonsynonymous_codon Average:72.984; most accessible tissue: Zhenshan97 panicle, score: 84.824 unknown unknown DELETERIOUS 0.00
vg0105163864 A -> DEL LOC_Os01g09930.1 N frameshift_variant Average:72.984; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105163864 2.51E-22 4.75E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 1.73E-14 5.94E-19 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 2.08E-06 1.96E-29 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 NA 5.86E-31 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 NA 3.95E-18 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 NA 1.21E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 NA 8.49E-06 mr1677 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 NA 1.18E-25 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 2.89E-06 3.03E-17 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 NA 3.13E-12 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 4.63E-25 5.08E-07 mr1057_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 4.86E-17 1.08E-20 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 3.46E-07 4.28E-33 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 NA 1.13E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 1.88E-06 5.83E-29 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 9.49E-07 3.01E-36 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 2.08E-06 1.20E-24 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864 4.36E-06 3.49E-22 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251