Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105163864:

Variant ID: vg0105163864 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5163864
Reference Allele: A	Alternative Allele: T,G
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTTCCTCGTCGGCGCACCACGCCGGTGCCGGCAGCTTCCAGTACTCCTCGTCGACGACGTCCTCCTCCGCCTCCTTCCGCTCCGCCTCCGTCTCGTGCA[A/T,G]
CCCGGAGAGCTCGGCGGCGGCGGCGCCAGAGTTGCCGGCGGCAACCGGCGGCGCGTTCAGTCGCTACGCGCGGCACCTCCGCCCGAGGAGGCCACCCAAG

Reverse complement sequence

CTTGGGTGGCCTCCTCGGGCGGAGGTGCCGCGCGTAGCGACTGAACGCGCCGCCGGTTGCCGCCGGCAACTCTGGCGCCGCCGCCGCCGAGCTCTCCGGG[T/A,C]
TGCACGAGACGGAGGCGGAGCGGAAGGAGGCGGAGGAGGACGTCGTCGACGAGGAGTACTGGAAGCTGCCGGCACCGGCGTGGTGCGCCGACGAGGAAGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.00%	27.50%	0.40%	7.00%	G: 0.08%
All Indica	2759	98.80%	0.90%	0.14%	0.07%	NA
All Japonica	1512	2.00%	76.50%	0.79%	20.63%	G: 0.07%
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	98.10%	1.50%	0.22%	0.22%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.30%	0.25%	0.13%	NA
Temperate Japonica	767	1.30%	83.80%	0.26%	14.60%	NA
Tropical Japonica	504	3.60%	63.10%	1.79%	31.35%	G: 0.20%
Japonica Intermediate	241	0.80%	81.30%	0.41%	17.43%	NA
VI/Aromatic	96	4.20%	79.20%	2.08%	14.58%	NA
Intermediate	90	48.90%	43.30%	1.11%	3.33%	G: 3.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105163864	A -> G	LOC_Os01g09930.1	missense_variant ; p.Asn98Ser; MODERATE	nonsynonymous_codon	Average:72.984; most accessible tissue: Zhenshan97 panicle, score: 84.824	unknown	unknown	TOLERATED	1.00
vg0105163864	A -> T	LOC_Os01g09930.1	missense_variant ; p.Asn98Ile; MODERATE	nonsynonymous_codon	Average:72.984; most accessible tissue: Zhenshan97 panicle, score: 84.824	unknown	unknown	DELETERIOUS	0.00
vg0105163864	A -> DEL	LOC_Os01g09930.1	N	frameshift_variant	Average:72.984; most accessible tissue: Zhenshan97 panicle, score: 84.824	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105163864	2.51E-22	4.75E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	1.73E-14	5.94E-19	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	2.08E-06	1.96E-29	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	NA	5.86E-31	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	NA	3.95E-18	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	NA	1.21E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	NA	8.49E-06	mr1677	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	NA	1.18E-25	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	2.89E-06	3.03E-17	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	NA	3.13E-12	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	4.63E-25	5.08E-07	mr1057_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	4.86E-17	1.08E-20	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	3.46E-07	4.28E-33	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	NA	1.13E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	1.88E-06	5.83E-29	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	9.49E-07	3.01E-36	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	2.08E-06	1.20E-24	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105163864	4.36E-06	3.49E-22	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251