\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105160384:

Variant ID: vg0105160384 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5160384
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTTTCTAATGATCGATCAAAAAATAAAAAAAAATTCTAAGCTTATGACATCTAGCTATGTTACATGTTATTTCTACTATTATTGTATAAGCTCCCGCG[G/A]
CAATGCGTTTGGTTTCATCTAGTTTCTAAGGATTCTGTGACTGAAAATCCTAAGAAATATTATCTTTCCTGTAGACTCCAGTGACAGAAGAAAATCATCC

Reverse complement sequence

GGATGATTTTCTTCTGTCACTGGAGTCTACAGGAAAGATAATATTTCTTAGGATTTTCAGTCACAGAATCCTTAGAAACTAGATGAAACCAAACGCATTG[C/T]
CGCGGGAGCTTATACAATAATAGTAGAAATAACATGTAACATAGCTAGATGTCATAAGCTTAGAATTTTTTTTTATTTTTTGATCGATCATTAGAAAAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.60% 14.30% 0.89% 10.18% NA
All Indica  2759 80.20% 19.20% 0.40% 0.22% NA
All Japonica  1512 66.70% 0.90% 1.79% 30.56% NA
Aus  269 53.20% 46.50% 0.37% 0.00% NA
Indica I  595 47.20% 52.60% 0.17% 0.00% NA
Indica II  465 97.40% 1.70% 0.65% 0.22% NA
Indica III  913 97.40% 2.30% 0.00% 0.33% NA
Indica Intermediate  786 75.10% 23.80% 0.89% 0.25% NA
Temperate Japonica  767 85.10% 0.10% 0.52% 14.21% NA
Tropical Japonica  504 33.10% 2.40% 4.37% 60.12% NA
Japonica Intermediate  241 78.40% 0.40% 0.41% 20.75% NA
VI/Aromatic  96 84.40% 3.10% 2.08% 10.42% NA
Intermediate  90 90.00% 5.60% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105160384 G -> A LOC_Os01g09930.1 upstream_gene_variant ; 2907.0bp to feature; MODIFIER silent_mutation Average:21.613; most accessible tissue: Zhenshan97 young leaf, score: 31.371 N N N N
vg0105160384 G -> A LOC_Os01g09900-LOC_Os01g09930 intergenic_region ; MODIFIER silent_mutation Average:21.613; most accessible tissue: Zhenshan97 young leaf, score: 31.371 N N N N
vg0105160384 G -> DEL N N silent_mutation Average:21.613; most accessible tissue: Zhenshan97 young leaf, score: 31.371 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105160384 NA 7.11E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384 NA 2.40E-06 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384 5.19E-06 5.41E-09 mr1445 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384 NA 1.70E-07 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384 NA 2.71E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384 NA 9.02E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384 NA 6.57E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384 NA 6.50E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384 NA 7.72E-06 mr1857 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251