\
| Variant ID: vg0105160384 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5160384 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 73. )
CCTTTTCTAATGATCGATCAAAAAATAAAAAAAAATTCTAAGCTTATGACATCTAGCTATGTTACATGTTATTTCTACTATTATTGTATAAGCTCCCGCG[G/A]
CAATGCGTTTGGTTTCATCTAGTTTCTAAGGATTCTGTGACTGAAAATCCTAAGAAATATTATCTTTCCTGTAGACTCCAGTGACAGAAGAAAATCATCC
GGATGATTTTCTTCTGTCACTGGAGTCTACAGGAAAGATAATATTTCTTAGGATTTTCAGTCACAGAATCCTTAGAAACTAGATGAAACCAAACGCATTG[C/T]
CGCGGGAGCTTATACAATAATAGTAGAAATAACATGTAACATAGCTAGATGTCATAAGCTTAGAATTTTTTTTTATTTTTTGATCGATCATTAGAAAAGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.60% | 14.30% | 0.89% | 10.18% | NA |
| All Indica | 2759 | 80.20% | 19.20% | 0.40% | 0.22% | NA |
| All Japonica | 1512 | 66.70% | 0.90% | 1.79% | 30.56% | NA |
| Aus | 269 | 53.20% | 46.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 47.20% | 52.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.40% | 1.70% | 0.65% | 0.22% | NA |
| Indica III | 913 | 97.40% | 2.30% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 75.10% | 23.80% | 0.89% | 0.25% | NA |
| Temperate Japonica | 767 | 85.10% | 0.10% | 0.52% | 14.21% | NA |
| Tropical Japonica | 504 | 33.10% | 2.40% | 4.37% | 60.12% | NA |
| Japonica Intermediate | 241 | 78.40% | 0.40% | 0.41% | 20.75% | NA |
| VI/Aromatic | 96 | 84.40% | 3.10% | 2.08% | 10.42% | NA |
| Intermediate | 90 | 90.00% | 5.60% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105160384 | G -> A | LOC_Os01g09930.1 | upstream_gene_variant ; 2907.0bp to feature; MODIFIER | silent_mutation | Average:21.613; most accessible tissue: Zhenshan97 young leaf, score: 31.371 | N | N | N | N |
| vg0105160384 | G -> A | LOC_Os01g09900-LOC_Os01g09930 | intergenic_region ; MODIFIER | silent_mutation | Average:21.613; most accessible tissue: Zhenshan97 young leaf, score: 31.371 | N | N | N | N |
| vg0105160384 | G -> DEL | N | N | silent_mutation | Average:21.613; most accessible tissue: Zhenshan97 young leaf, score: 31.371 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105160384 | NA | 7.11E-06 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105160384 | NA | 2.40E-06 | mr1316 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105160384 | 5.19E-06 | 5.41E-09 | mr1445 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105160384 | NA | 1.70E-07 | mr1485 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105160384 | NA | 2.71E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105160384 | NA | 9.02E-08 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105160384 | NA | 6.57E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105160384 | NA | 6.50E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105160384 | NA | 7.72E-06 | mr1857 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |