Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105160384:

Variant ID: vg0105160384 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5160384
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

CCTTTTCTAATGATCGATCAAAAAATAAAAAAAAATTCTAAGCTTATGACATCTAGCTATGTTACATGTTATTTCTACTATTATTGTATAAGCTCCCGCG[G/A]
CAATGCGTTTGGTTTCATCTAGTTTCTAAGGATTCTGTGACTGAAAATCCTAAGAAATATTATCTTTCCTGTAGACTCCAGTGACAGAAGAAAATCATCC

Reverse complement sequence

GGATGATTTTCTTCTGTCACTGGAGTCTACAGGAAAGATAATATTTCTTAGGATTTTCAGTCACAGAATCCTTAGAAACTAGATGAAACCAAACGCATTG[C/T]
CGCGGGAGCTTATACAATAATAGTAGAAATAACATGTAACATAGCTAGATGTCATAAGCTTAGAATTTTTTTTTATTTTTTGATCGATCATTAGAAAAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.60%	14.30%	0.89%	10.18%	NA
All Indica	2759	80.20%	19.20%	0.40%	0.22%	NA
All Japonica	1512	66.70%	0.90%	1.79%	30.56%	NA
Aus	269	53.20%	46.50%	0.37%	0.00%	NA
Indica I	595	47.20%	52.60%	0.17%	0.00%	NA
Indica II	465	97.40%	1.70%	0.65%	0.22%	NA
Indica III	913	97.40%	2.30%	0.00%	0.33%	NA
Indica Intermediate	786	75.10%	23.80%	0.89%	0.25%	NA
Temperate Japonica	767	85.10%	0.10%	0.52%	14.21%	NA
Tropical Japonica	504	33.10%	2.40%	4.37%	60.12%	NA
Japonica Intermediate	241	78.40%	0.40%	0.41%	20.75%	NA
VI/Aromatic	96	84.40%	3.10%	2.08%	10.42%	NA
Intermediate	90	90.00%	5.60%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105160384	G -> A	LOC_Os01g09930.1	upstream_gene_variant ; 2907.0bp to feature; MODIFIER	silent_mutation	Average:21.613; most accessible tissue: Zhenshan97 young leaf, score: 31.371	N	N	N	N
vg0105160384	G -> A	LOC_Os01g09900-LOC_Os01g09930	intergenic_region ; MODIFIER	silent_mutation	Average:21.613; most accessible tissue: Zhenshan97 young leaf, score: 31.371	N	N	N	N
vg0105160384	G -> DEL	N	N	silent_mutation	Average:21.613; most accessible tissue: Zhenshan97 young leaf, score: 31.371	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105160384	NA	7.11E-06	mr1048	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384	NA	2.40E-06	mr1316	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384	5.19E-06	5.41E-09	mr1445	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384	NA	1.70E-07	mr1485	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384	NA	2.71E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384	NA	9.02E-08	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384	NA	6.57E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384	NA	6.50E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105160384	NA	7.72E-06	mr1857	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251