\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105159820:

Variant ID: vg0105159820 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5159820
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGACCCAGTTTCTTCCTCTCTTCACTTTCTCTCTTAATTAATATAGTGCCACATAAGTTAAAAGTCCTACATGGCAATGTAGTTAATACCATAGACAC[C/A]
ATCCTATGTGGAGGGTTGGGACTGCCCTAAAGCTACAACCAACTAAATCCTAAAACTCAACATGCAAAAGTGCAACATTATCATCCATTAGCAATTATTA

Reverse complement sequence

TAATAATTGCTAATGGATGATAATGTTGCACTTTTGCATGTTGAGTTTTAGGATTTAGTTGGTTGTAGCTTTAGGGCAGTCCCAACCCTCCACATAGGAT[G/T]
GTGTCTATGGTATTAACTACATTGCCATGTAGGACTTTTAACTTATGTGGCACTATATTAATTAAGAGAGAAAGTGAAGAGAGGAAGAAACTGGGTCTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.70% 14.20% 0.68% 10.41% NA
All Indica  2759 80.10% 19.00% 0.18% 0.69% NA
All Japonica  1512 67.00% 1.10% 1.65% 30.29% NA
Aus  269 52.80% 46.50% 0.37% 0.37% NA
Indica I  595 47.20% 52.10% 0.17% 0.50% NA
Indica II  465 97.40% 1.70% 0.22% 0.65% NA
Indica III  913 97.30% 2.20% 0.11% 0.44% NA
Indica Intermediate  786 74.90% 23.70% 0.25% 1.15% NA
Temperate Japonica  767 85.30% 0.10% 0.26% 14.34% NA
Tropical Japonica  504 33.70% 2.80% 4.37% 59.13% NA
Japonica Intermediate  241 78.40% 0.40% 0.41% 20.75% NA
VI/Aromatic  96 85.40% 3.10% 0.00% 11.46% NA
Intermediate  90 90.00% 5.60% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105159820 C -> A LOC_Os01g09930.1 upstream_gene_variant ; 3471.0bp to feature; MODIFIER silent_mutation Average:27.908; most accessible tissue: Callus, score: 36.365 N N N N
vg0105159820 C -> A LOC_Os01g09900-LOC_Os01g09930 intergenic_region ; MODIFIER silent_mutation Average:27.908; most accessible tissue: Callus, score: 36.365 N N N N
vg0105159820 C -> DEL N N silent_mutation Average:27.908; most accessible tissue: Callus, score: 36.365 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105159820 NA 3.02E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 3.44E-06 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 3.92E-06 mr1351 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 6.00E-06 mr1394 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 4.43E-06 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 1.11E-08 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 7.20E-06 mr1470 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 3.26E-08 mr1485 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 1.69E-06 1.69E-06 mr1485 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 2.03E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 5.50E-06 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 4.35E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 1.46E-06 mr1600 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 3.95E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 2.11E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 2.58E-06 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 1.05E-06 mr1988 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105159820 NA 7.56E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251