\
| Variant ID: vg0105159820 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5159820 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 63. )
TGAGACCCAGTTTCTTCCTCTCTTCACTTTCTCTCTTAATTAATATAGTGCCACATAAGTTAAAAGTCCTACATGGCAATGTAGTTAATACCATAGACAC[C/A]
ATCCTATGTGGAGGGTTGGGACTGCCCTAAAGCTACAACCAACTAAATCCTAAAACTCAACATGCAAAAGTGCAACATTATCATCCATTAGCAATTATTA
TAATAATTGCTAATGGATGATAATGTTGCACTTTTGCATGTTGAGTTTTAGGATTTAGTTGGTTGTAGCTTTAGGGCAGTCCCAACCCTCCACATAGGAT[G/T]
GTGTCTATGGTATTAACTACATTGCCATGTAGGACTTTTAACTTATGTGGCACTATATTAATTAAGAGAGAAAGTGAAGAGAGGAAGAAACTGGGTCTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.70% | 14.20% | 0.68% | 10.41% | NA |
| All Indica | 2759 | 80.10% | 19.00% | 0.18% | 0.69% | NA |
| All Japonica | 1512 | 67.00% | 1.10% | 1.65% | 30.29% | NA |
| Aus | 269 | 52.80% | 46.50% | 0.37% | 0.37% | NA |
| Indica I | 595 | 47.20% | 52.10% | 0.17% | 0.50% | NA |
| Indica II | 465 | 97.40% | 1.70% | 0.22% | 0.65% | NA |
| Indica III | 913 | 97.30% | 2.20% | 0.11% | 0.44% | NA |
| Indica Intermediate | 786 | 74.90% | 23.70% | 0.25% | 1.15% | NA |
| Temperate Japonica | 767 | 85.30% | 0.10% | 0.26% | 14.34% | NA |
| Tropical Japonica | 504 | 33.70% | 2.80% | 4.37% | 59.13% | NA |
| Japonica Intermediate | 241 | 78.40% | 0.40% | 0.41% | 20.75% | NA |
| VI/Aromatic | 96 | 85.40% | 3.10% | 0.00% | 11.46% | NA |
| Intermediate | 90 | 90.00% | 5.60% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105159820 | C -> A | LOC_Os01g09930.1 | upstream_gene_variant ; 3471.0bp to feature; MODIFIER | silent_mutation | Average:27.908; most accessible tissue: Callus, score: 36.365 | N | N | N | N |
| vg0105159820 | C -> A | LOC_Os01g09900-LOC_Os01g09930 | intergenic_region ; MODIFIER | silent_mutation | Average:27.908; most accessible tissue: Callus, score: 36.365 | N | N | N | N |
| vg0105159820 | C -> DEL | N | N | silent_mutation | Average:27.908; most accessible tissue: Callus, score: 36.365 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105159820 | NA | 3.02E-06 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 3.44E-06 | mr1316 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 3.92E-06 | mr1351 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 6.00E-06 | mr1394 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 4.43E-06 | mr1427 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 1.11E-08 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 7.20E-06 | mr1470 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 3.26E-08 | mr1485 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | 1.69E-06 | 1.69E-06 | mr1485 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 2.03E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 5.50E-06 | mr1564 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 4.35E-08 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 1.46E-06 | mr1600 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 3.95E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 2.11E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 2.58E-06 | mr1888 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 1.05E-06 | mr1988 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105159820 | NA | 7.56E-06 | mr1814_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |