\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105158575:

Variant ID: vg0105158575 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5158575
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATACACAATATGTTAATAGTGGGCTCCACACACTATTCCTCCTCCCAACATGGCACCGACTCTTCTCCGGTGCCATTGAGCTCGTCCTCTACCGATTGTT[G/A]
CCCCTTCCCTGGCGCCGCCTAGTTTGTTCACCTTGTCAATTACTGCCCCTTCTCCATTGAACTCGTCCTCTGCCCCCCTCAAGCCAAAATCTGTTGACTA

Reverse complement sequence

TAGTCAACAGATTTTGGCTTGAGGGGGGCAGAGGACGAGTTCAATGGAGAAGGGGCAGTAATTGACAAGGTGAACAAACTAGGCGGCGCCAGGGAAGGGG[C/T]
AACAATCGGTAGAGGACGAGCTCAATGGCACCGGAGAAGAGTCGGTGCCATGTTGGGAGGAGGAATAGTGTGTGGAGCCCACTATTAACATATTGTGTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.60% 14.30% 0.99% 10.14% NA
All Indica  2759 80.00% 19.10% 0.14% 0.80% NA
All Japonica  1512 67.20% 1.10% 2.51% 29.23% NA
Aus  269 53.20% 46.10% 0.37% 0.37% NA
Indica I  595 46.60% 52.60% 0.34% 0.50% NA
Indica II  465 97.40% 1.70% 0.00% 0.86% NA
Indica III  913 97.30% 2.10% 0.11% 0.55% NA
Indica Intermediate  786 74.80% 23.80% 0.13% 1.27% NA
Temperate Japonica  767 85.40% 0.10% 0.78% 13.69% NA
Tropical Japonica  504 33.90% 2.80% 6.15% 57.14% NA
Japonica Intermediate  241 78.80% 0.40% 0.41% 20.33% NA
VI/Aromatic  96 82.30% 3.10% 3.12% 11.46% NA
Intermediate  90 90.00% 5.60% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105158575 G -> A LOC_Os01g09930.1 upstream_gene_variant ; 4716.0bp to feature; MODIFIER silent_mutation Average:56.647; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0105158575 G -> A LOC_Os01g09900-LOC_Os01g09930 intergenic_region ; MODIFIER silent_mutation Average:56.647; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0105158575 G -> DEL N N silent_mutation Average:56.647; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105158575 NA 3.47E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 8.35E-06 mr1196 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 7.47E-07 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 2.64E-06 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 3.99E-06 mr1351 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 3.87E-06 4.38E-09 mr1445 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 5.79E-06 mr1470 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 4.50E-08 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 3.46E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 8.87E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 7.76E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 9.95E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 8.29E-06 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 6.59E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 6.58E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 5.79E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 1.61E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 5.92E-06 mr1857 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575 NA 5.76E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251