Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0105158575:

Variant ID: vg0105158575 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5158575
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATACACAATATGTTAATAGTGGGCTCCACACACTATTCCTCCTCCCAACATGGCACCGACTCTTCTCCGGTGCCATTGAGCTCGTCCTCTACCGATTGTT[G/A]
CCCCTTCCCTGGCGCCGCCTAGTTTGTTCACCTTGTCAATTACTGCCCCTTCTCCATTGAACTCGTCCTCTGCCCCCCTCAAGCCAAAATCTGTTGACTA

Reverse complement sequence

TAGTCAACAGATTTTGGCTTGAGGGGGGCAGAGGACGAGTTCAATGGAGAAGGGGCAGTAATTGACAAGGTGAACAAACTAGGCGGCGCCAGGGAAGGGG[C/T]
AACAATCGGTAGAGGACGAGCTCAATGGCACCGGAGAAGAGTCGGTGCCATGTTGGGAGGAGGAATAGTGTGTGGAGCCCACTATTAACATATTGTGTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.60%	14.30%	0.99%	10.14%	NA
All Indica	2759	80.00%	19.10%	0.14%	0.80%	NA
All Japonica	1512	67.20%	1.10%	2.51%	29.23%	NA
Aus	269	53.20%	46.10%	0.37%	0.37%	NA
Indica I	595	46.60%	52.60%	0.34%	0.50%	NA
Indica II	465	97.40%	1.70%	0.00%	0.86%	NA
Indica III	913	97.30%	2.10%	0.11%	0.55%	NA
Indica Intermediate	786	74.80%	23.80%	0.13%	1.27%	NA
Temperate Japonica	767	85.40%	0.10%	0.78%	13.69%	NA
Tropical Japonica	504	33.90%	2.80%	6.15%	57.14%	NA
Japonica Intermediate	241	78.80%	0.40%	0.41%	20.33%	NA
VI/Aromatic	96	82.30%	3.10%	3.12%	11.46%	NA
Intermediate	90	90.00%	5.60%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105158575	G -> A	LOC_Os01g09930.1	upstream_gene_variant ; 4716.0bp to feature; MODIFIER	silent_mutation	Average:56.647; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0105158575	G -> A	LOC_Os01g09900-LOC_Os01g09930	intergenic_region ; MODIFIER	silent_mutation	Average:56.647; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0105158575	G -> DEL	N	N	silent_mutation	Average:56.647; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105158575	NA	3.47E-06	mr1048	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	8.35E-06	mr1196	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	7.47E-07	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	2.64E-06	mr1316	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	3.99E-06	mr1351	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	3.87E-06	4.38E-09	mr1445	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	5.79E-06	mr1470	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	4.50E-08	mr1485	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	3.46E-07	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	8.87E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	7.76E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	9.95E-06	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	8.29E-06	mr1564	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	6.59E-08	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	6.58E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	5.79E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	1.61E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	5.92E-06	mr1857	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105158575	NA	5.76E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251