\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105148196:

Variant ID: vg0105148196 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5148196
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.11, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


GCATATTTATTTATAATATTTTGAAACCAGCTTATTTTAAATAATATTTTGTAGTATCGTAGGGATCGTAGAATTGAGATAACACCTAAAATTTCGTAGG[A/G]
TTGTTCTCTTGTCGATCGATCTCTGAATAAATTAAAGCTTCCCGGCTCCGGCCGCTAGCAGTTGCTTCTTTTTCCCACATTCTCTCATGGATATCGATCC

Reverse complement sequence

GGATCGATATCCATGAGAGAATGTGGGAAAAAGAAGCAACTGCTAGCGGCCGGAGCCGGGAAGCTTTAATTTATTCAGAGATCGATCGACAAGAGAACAA[T/C]
CCTACGAAATTTTAGGTGTTATCTCAATTCTACGATCCCTACGATACTACAAAATATTATTTAAAATAAGCTGGTTTCAAAATATTATAAATAAATATGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.20% 45.30% 0.49% 6.96% NA
All Indica  2759 74.40% 25.10% 0.40% 0.07% NA
All Japonica  1512 1.30% 77.60% 0.46% 20.57% NA
Aus  269 32.70% 66.50% 0.74% 0.00% NA
Indica I  595 45.50% 53.60% 0.84% 0.00% NA
Indica II  465 78.10% 21.50% 0.22% 0.22% NA
Indica III  913 96.50% 3.40% 0.11% 0.00% NA
Indica Intermediate  786 68.60% 30.80% 0.51% 0.13% NA
Temperate Japonica  767 1.30% 84.10% 0.13% 14.47% NA
Tropical Japonica  504 1.40% 66.10% 1.19% 31.35% NA
Japonica Intermediate  241 1.20% 81.30% 0.00% 17.43% NA
VI/Aromatic  96 25.00% 58.30% 2.08% 14.58% NA
Intermediate  90 50.00% 46.70% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105148196 A -> G LOC_Os01g09900.1 upstream_gene_variant ; 498.0bp to feature; MODIFIER silent_mutation Average:44.592; most accessible tissue: Zhenshan97 root, score: 88.397 N N N N
vg0105148196 A -> G LOC_Os01g09890-LOC_Os01g09900 intergenic_region ; MODIFIER silent_mutation Average:44.592; most accessible tissue: Zhenshan97 root, score: 88.397 N N N N
vg0105148196 A -> DEL N N silent_mutation Average:44.592; most accessible tissue: Zhenshan97 root, score: 88.397 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105148196 NA 5.74E-11 mr1316 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105148196 NA 3.31E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105148196 NA 1.49E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105148196 NA 9.44E-07 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105148196 NA 9.82E-07 mr1908 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105148196 9.75E-07 1.80E-18 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105148196 6.35E-06 1.35E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105148196 NA 4.43E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251