Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0105148196:

Variant ID: vg0105148196 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5148196
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.11, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

GCATATTTATTTATAATATTTTGAAACCAGCTTATTTTAAATAATATTTTGTAGTATCGTAGGGATCGTAGAATTGAGATAACACCTAAAATTTCGTAGG[A/G]
TTGTTCTCTTGTCGATCGATCTCTGAATAAATTAAAGCTTCCCGGCTCCGGCCGCTAGCAGTTGCTTCTTTTTCCCACATTCTCTCATGGATATCGATCC

Reverse complement sequence

GGATCGATATCCATGAGAGAATGTGGGAAAAAGAAGCAACTGCTAGCGGCCGGAGCCGGGAAGCTTTAATTTATTCAGAGATCGATCGACAAGAGAACAA[T/C]
CCTACGAAATTTTAGGTGTTATCTCAATTCTACGATCCCTACGATACTACAAAATATTATTTAAAATAAGCTGGTTTCAAAATATTATAAATAAATATGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.20%	45.30%	0.49%	6.96%	NA
All Indica	2759	74.40%	25.10%	0.40%	0.07%	NA
All Japonica	1512	1.30%	77.60%	0.46%	20.57%	NA
Aus	269	32.70%	66.50%	0.74%	0.00%	NA
Indica I	595	45.50%	53.60%	0.84%	0.00%	NA
Indica II	465	78.10%	21.50%	0.22%	0.22%	NA
Indica III	913	96.50%	3.40%	0.11%	0.00%	NA
Indica Intermediate	786	68.60%	30.80%	0.51%	0.13%	NA
Temperate Japonica	767	1.30%	84.10%	0.13%	14.47%	NA
Tropical Japonica	504	1.40%	66.10%	1.19%	31.35%	NA
Japonica Intermediate	241	1.20%	81.30%	0.00%	17.43%	NA
VI/Aromatic	96	25.00%	58.30%	2.08%	14.58%	NA
Intermediate	90	50.00%	46.70%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105148196	A -> G	LOC_Os01g09900.1	upstream_gene_variant ; 498.0bp to feature; MODIFIER	silent_mutation	Average:44.592; most accessible tissue: Zhenshan97 root, score: 88.397	N	N	N	N
vg0105148196	A -> G	LOC_Os01g09890-LOC_Os01g09900	intergenic_region ; MODIFIER	silent_mutation	Average:44.592; most accessible tissue: Zhenshan97 root, score: 88.397	N	N	N	N
vg0105148196	A -> DEL	N	N	silent_mutation	Average:44.592; most accessible tissue: Zhenshan97 root, score: 88.397	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105148196	NA	5.74E-11	mr1316	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105148196	NA	3.31E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105148196	NA	1.49E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105148196	NA	9.44E-07	mr1875	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105148196	NA	9.82E-07	mr1908	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105148196	9.75E-07	1.80E-18	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105148196	6.35E-06	1.35E-13	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105148196	NA	4.43E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251