\
| Variant ID: vg0105148196 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5148196 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.11, others allele: 0.00, population size: 63. )
GCATATTTATTTATAATATTTTGAAACCAGCTTATTTTAAATAATATTTTGTAGTATCGTAGGGATCGTAGAATTGAGATAACACCTAAAATTTCGTAGG[A/G]
TTGTTCTCTTGTCGATCGATCTCTGAATAAATTAAAGCTTCCCGGCTCCGGCCGCTAGCAGTTGCTTCTTTTTCCCACATTCTCTCATGGATATCGATCC
GGATCGATATCCATGAGAGAATGTGGGAAAAAGAAGCAACTGCTAGCGGCCGGAGCCGGGAAGCTTTAATTTATTCAGAGATCGATCGACAAGAGAACAA[T/C]
CCTACGAAATTTTAGGTGTTATCTCAATTCTACGATCCCTACGATACTACAAAATATTATTTAAAATAAGCTGGTTTCAAAATATTATAAATAAATATGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.20% | 45.30% | 0.49% | 6.96% | NA |
| All Indica | 2759 | 74.40% | 25.10% | 0.40% | 0.07% | NA |
| All Japonica | 1512 | 1.30% | 77.60% | 0.46% | 20.57% | NA |
| Aus | 269 | 32.70% | 66.50% | 0.74% | 0.00% | NA |
| Indica I | 595 | 45.50% | 53.60% | 0.84% | 0.00% | NA |
| Indica II | 465 | 78.10% | 21.50% | 0.22% | 0.22% | NA |
| Indica III | 913 | 96.50% | 3.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 68.60% | 30.80% | 0.51% | 0.13% | NA |
| Temperate Japonica | 767 | 1.30% | 84.10% | 0.13% | 14.47% | NA |
| Tropical Japonica | 504 | 1.40% | 66.10% | 1.19% | 31.35% | NA |
| Japonica Intermediate | 241 | 1.20% | 81.30% | 0.00% | 17.43% | NA |
| VI/Aromatic | 96 | 25.00% | 58.30% | 2.08% | 14.58% | NA |
| Intermediate | 90 | 50.00% | 46.70% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105148196 | A -> G | LOC_Os01g09900.1 | upstream_gene_variant ; 498.0bp to feature; MODIFIER | silent_mutation | Average:44.592; most accessible tissue: Zhenshan97 root, score: 88.397 | N | N | N | N |
| vg0105148196 | A -> G | LOC_Os01g09890-LOC_Os01g09900 | intergenic_region ; MODIFIER | silent_mutation | Average:44.592; most accessible tissue: Zhenshan97 root, score: 88.397 | N | N | N | N |
| vg0105148196 | A -> DEL | N | N | silent_mutation | Average:44.592; most accessible tissue: Zhenshan97 root, score: 88.397 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105148196 | NA | 5.74E-11 | mr1316 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105148196 | NA | 3.31E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105148196 | NA | 1.49E-07 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105148196 | NA | 9.44E-07 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105148196 | NA | 9.82E-07 | mr1908 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105148196 | 9.75E-07 | 1.80E-18 | mr1916 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105148196 | 6.35E-06 | 1.35E-13 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105148196 | NA | 4.43E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |