\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105146788:

Variant ID: vg0105146788 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5146788
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGGCAATATTTTCTTAAAATATTTACTATAACTAGAAAAAATGCCTGTGCGTTGCAACGTTGCAATGGGTGAGGTTATTTTAATCTTATCATTGTTATA[C/T]
GGTTTAATTAAGGTGAAGTTTACTATGTGAATTTGCTTGAATATATATATATATTTTTAGAAAATCATAAGCTGCAATTAGAAGTCCGATCATCTCAAGT

Reverse complement sequence

ACTTGAGATGATCGGACTTCTAATTGCAGCTTATGATTTTCTAAAAATATATATATATATTCAAGCAAATTCACATAGTAAACTTCACCTTAATTAAACC[G/A]
TATAACAATGATAAGATTAAAATAACCTCACCCATTGCAACGTTGCAACGCACAGGCATTTTTTCTAGTTATAGTAAATATTTTAAGAAAATATTGCCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.70% 6.20% 0.42% 0.72% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 78.60% 18.40% 0.86% 2.18% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 85.50% 12.10% 0.39% 1.96% NA
Tropical Japonica  504 66.30% 30.40% 0.99% 2.38% NA
Japonica Intermediate  241 82.20% 13.30% 2.07% 2.49% NA
VI/Aromatic  96 83.30% 9.40% 7.29% 0.00% NA
Intermediate  90 96.70% 2.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105146788 C -> T LOC_Os01g09900.1 upstream_gene_variant ; 1906.0bp to feature; MODIFIER silent_mutation Average:20.822; most accessible tissue: Callus, score: 31.884 N N N N
vg0105146788 C -> T LOC_Os01g09890-LOC_Os01g09900 intergenic_region ; MODIFIER silent_mutation Average:20.822; most accessible tissue: Callus, score: 31.884 N N N N
vg0105146788 C -> DEL N N silent_mutation Average:20.822; most accessible tissue: Callus, score: 31.884 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105146788 4.51E-24 2.32E-26 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105146788 7.06E-14 4.34E-20 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105146788 9.51E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105146788 3.75E-06 NA mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105146788 3.59E-06 4.03E-07 mr1677 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105146788 2.16E-33 1.17E-38 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105146788 1.58E-18 2.47E-23 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105146788 1.65E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105146788 9.25E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105146788 1.92E-06 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251