\
| Variant ID: vg0105146788 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5146788 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGGGCAATATTTTCTTAAAATATTTACTATAACTAGAAAAAATGCCTGTGCGTTGCAACGTTGCAATGGGTGAGGTTATTTTAATCTTATCATTGTTATA[C/T]
GGTTTAATTAAGGTGAAGTTTACTATGTGAATTTGCTTGAATATATATATATATTTTTAGAAAATCATAAGCTGCAATTAGAAGTCCGATCATCTCAAGT
ACTTGAGATGATCGGACTTCTAATTGCAGCTTATGATTTTCTAAAAATATATATATATATTCAAGCAAATTCACATAGTAAACTTCACCTTAATTAAACC[G/A]
TATAACAATGATAAGATTAAAATAACCTCACCCATTGCAACGTTGCAACGCACAGGCATTTTTTCTAGTTATAGTAAATATTTTAAGAAAATATTGCCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.70% | 6.20% | 0.42% | 0.72% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 78.60% | 18.40% | 0.86% | 2.18% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 85.50% | 12.10% | 0.39% | 1.96% | NA |
| Tropical Japonica | 504 | 66.30% | 30.40% | 0.99% | 2.38% | NA |
| Japonica Intermediate | 241 | 82.20% | 13.30% | 2.07% | 2.49% | NA |
| VI/Aromatic | 96 | 83.30% | 9.40% | 7.29% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105146788 | C -> T | LOC_Os01g09900.1 | upstream_gene_variant ; 1906.0bp to feature; MODIFIER | silent_mutation | Average:20.822; most accessible tissue: Callus, score: 31.884 | N | N | N | N |
| vg0105146788 | C -> T | LOC_Os01g09890-LOC_Os01g09900 | intergenic_region ; MODIFIER | silent_mutation | Average:20.822; most accessible tissue: Callus, score: 31.884 | N | N | N | N |
| vg0105146788 | C -> DEL | N | N | silent_mutation | Average:20.822; most accessible tissue: Callus, score: 31.884 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105146788 | 4.51E-24 | 2.32E-26 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105146788 | 7.06E-14 | 4.34E-20 | mr1057 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105146788 | 9.51E-06 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105146788 | 3.75E-06 | NA | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105146788 | 3.59E-06 | 4.03E-07 | mr1677 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105146788 | 2.16E-33 | 1.17E-38 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105146788 | 1.58E-18 | 2.47E-23 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105146788 | 1.65E-06 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105146788 | 9.25E-06 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105146788 | 1.92E-06 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |