\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105137567:

Variant ID: vg0105137567 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5137567
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGCATTTGATTTTTCTTTTTTGTTAAACATCTCTCTCTCTCCATCCAATCCAACTACGTGGATGGAGGTTGAGTGCGCCAGATGTCATGCTCCTACTT[G/A]
TTGGCCAACCGTCGACAAGGCGCCGGCGCAGTGGCTGCGTGTTGAAGGTGTTTAGTTGGCAGTAGCTGCTGAGGCTAGGAGGTGCACTTCGGCATGGGAG

Reverse complement sequence

CTCCCATGCCGAAGTGCACCTCCTAGCCTCAGCAGCTACTGCCAACTAAACACCTTCAACACGCAGCCACTGCGCCGGCGCCTTGTCGACGGTTGGCCAA[C/T]
AAGTAGGAGCATGACATCTGGCGCACTCAACCTCCATCCACGTAGTTGGATTGGATGGAGAGAGAGAGATGTTTAACAAAAAAGAAAAATCAAATGCTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.20% 15.50% 0.23% 0.02% NA
All Indica  2759 80.10% 19.50% 0.33% 0.04% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 34.60% 64.70% 0.74% 0.00% NA
Indica I  595 45.70% 54.10% 0.17% 0.00% NA
Indica II  465 97.80% 1.70% 0.22% 0.22% NA
Indica III  913 97.60% 2.20% 0.22% 0.00% NA
Indica Intermediate  786 75.30% 24.00% 0.64% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105137567 G -> A LOC_Os01g09880.1 upstream_gene_variant ; 4649.0bp to feature; MODIFIER silent_mutation Average:83.856; most accessible tissue: Minghui63 flag leaf, score: 91.823 N N N N
vg0105137567 G -> A LOC_Os01g09890.1 downstream_gene_variant ; 896.0bp to feature; MODIFIER silent_mutation Average:83.856; most accessible tissue: Minghui63 flag leaf, score: 91.823 N N N N
vg0105137567 G -> A LOC_Os01g09880-LOC_Os01g09890 intergenic_region ; MODIFIER silent_mutation Average:83.856; most accessible tissue: Minghui63 flag leaf, score: 91.823 N N N N
vg0105137567 G -> DEL N N silent_mutation Average:83.856; most accessible tissue: Minghui63 flag leaf, score: 91.823 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0105137567 G A -0.15 -0.11 -0.08 -0.05 -0.12 -0.12

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105137567 NA 1.48E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 1.83E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 1.35E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 4.82E-06 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 2.17E-06 mr1351 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 9.98E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 3.73E-06 3.72E-06 mr1370 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 6.12E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 9.10E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 8.21E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 8.71E-08 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 1.51E-06 mr1470 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 1.83E-07 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 7.89E-06 7.89E-06 mr1485 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 4.27E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 7.48E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 5.77E-06 5.07E-07 mr1564 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 9.92E-09 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 4.40E-06 mr1600 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 7.97E-06 mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 2.38E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 5.01E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 7.82E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 1.50E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 4.10E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 1.30E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 5.68E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 2.00E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 9.64E-06 mr1988 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 1.79E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105137567 NA 1.32E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251