\
| Variant ID: vg0105135512 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5135512 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )
TTTTCGATAATAAAATTGAATCCAACCTCTATATCAAAACGTGTATAATAAGGCCAGATTGAGCTAGGCTAGCAAACACCTTAGGGTTTGCTTCACGATT[G/A]
AGTATGTTCAGTAAACAAGAAAACCGTTAGCATATGATTAATTAAGTTTTACTTATCTTAAACTTGAAAAGTGAATTTATCTGATATTTTAAAGCAACTT
AAGTTGCTTTAAAATATCAGATAAATTCACTTTTCAAGTTTAAGATAAGTAAAACTTAATTAATCATATGCTAACGGTTTTCTTGTTTACTGAACATACT[C/T]
AATCGTGAAGCAAACCCTAAGGTGTTTGCTAGCCTAGCTCAATCTGGCCTTATTATACACGTTTTGATATAGAGGTTGGATTCAATTTTATTATCGAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.60% | 17.10% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 75.60% | 24.00% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 53.20% | 46.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 27.90% | 71.40% | 0.67% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 97.60% | 2.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 73.30% | 26.10% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105135512 | G -> A | LOC_Os01g09880.1 | upstream_gene_variant ; 2594.0bp to feature; MODIFIER | silent_mutation | Average:57.065; most accessible tissue: Callus, score: 85.038 | N | N | N | N |
| vg0105135512 | G -> A | LOC_Os01g09890.1 | downstream_gene_variant ; 2951.0bp to feature; MODIFIER | silent_mutation | Average:57.065; most accessible tissue: Callus, score: 85.038 | N | N | N | N |
| vg0105135512 | G -> A | LOC_Os01g09880-LOC_Os01g09890 | intergenic_region ; MODIFIER | silent_mutation | Average:57.065; most accessible tissue: Callus, score: 85.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105135512 | NA | 9.75E-06 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 1.47E-07 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | 4.55E-06 | NA | mr1375 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 4.54E-06 | mr1375 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 2.29E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 1.15E-06 | mr1485 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 7.81E-07 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 3.24E-06 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 3.60E-07 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 1.33E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 4.17E-07 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 8.03E-06 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 8.83E-08 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 1.33E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 8.77E-07 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 1.08E-07 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 4.27E-06 | mr1127_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 4.87E-06 | mr1137_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | 9.85E-07 | NA | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 5.15E-09 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 5.76E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 1.94E-08 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 2.56E-07 | mr1659_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 2.71E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 1.41E-07 | mr1805_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 2.64E-06 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 2.76E-06 | mr1957_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105135512 | NA | 6.51E-06 | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |