\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105135246:

Variant ID: vg0105135246 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 5135246
Reference Allele: CTAGTAAlternative Allele: ATAGTA,TTAGTA,C
Primary Allele: CTAGTASecondary Allele: ATAGTA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCATCTCCCCCATGGATTTTAGTGGATGCACAAGCTGTACAAAAGCTAAGGACAAAACCAATTCATCATGTGAGCAAGTACTCTCTTAAAAAAAGACAT[CTAGTA/ATAGTA,TTAGTA,C]
TAGTGGTTGCAGTGACCTGAGTAGCGTTATAAGATTCTGAGTTTCTAATATTAAATAAATTTGACCAGCGAGAGTTATTAGTCATCAGAAATCTGGCTTG

Reverse complement sequence

CAAGCCAGATTTCTGATGACTAATAACTCTCGCTGGTCAAATTTATTTAATATTAGAAACTCAGAATCTTATAACGCTACTCAGGTCACTGCAACCACTA[TACTAG/TACTAT,TACTAA,G]
ATGTCTTTTTTTAAGAGAGTACTTGCTCACATGATGAATTGGTTTTGTCCTTAGCTTTTGTACAGCTTGTGCATCCACTAAAATCCATGGGGGAGATGCA

Allele Frequencies:

Populations Population SizeFrequency of CTAGTA(primary allele) Frequency of ATAGTA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.20% 7.40% 1.63% 60.62% TTAGTA: 0.06%; C: 0.06%
All Indica  2759 6.70% 0.10% 1.59% 91.59% NA
All Japonica  1512 75.90% 21.80% 0.13% 1.98% TTAGTA: 0.20%; C: 0.07%
Aus  269 1.90% 0.00% 11.15% 86.99% NA
Indica I  595 0.80% 0.00% 0.34% 98.82% NA
Indica II  465 20.40% 0.20% 2.37% 76.99% NA
Indica III  913 2.70% 0.00% 1.31% 95.95% NA
Indica Intermediate  786 7.80% 0.10% 2.42% 89.69% NA
Temperate Japonica  767 83.30% 14.90% 0.26% 1.30% TTAGTA: 0.26%
Tropical Japonica  504 62.30% 34.10% 0.00% 3.37% C: 0.20%
Japonica Intermediate  241 80.50% 17.80% 0.00% 1.24% TTAGTA: 0.41%
VI/Aromatic  96 58.30% 15.60% 0.00% 26.04% NA
Intermediate  90 37.80% 4.40% 1.11% 54.44% C: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105135246 CTAGTA -> ATAGTA LOC_Os01g09880.1 upstream_gene_variant ; 2328.0bp to feature; MODIFIER silent_mutation Average:77.946; most accessible tissue: Callus, score: 96.201 N N N N
vg0105135246 CTAGTA -> ATAGTA LOC_Os01g09890.1 downstream_gene_variant ; 3217.0bp to feature; MODIFIER silent_mutation Average:77.946; most accessible tissue: Callus, score: 96.201 N N N N
vg0105135246 CTAGTA -> ATAGTA LOC_Os01g09880-LOC_Os01g09890 intergenic_region ; MODIFIER silent_mutation Average:77.946; most accessible tissue: Callus, score: 96.201 N N N N
vg0105135246 CTAGTA -> TTAGTA LOC_Os01g09880.1 upstream_gene_variant ; 2328.0bp to feature; MODIFIER silent_mutation Average:77.946; most accessible tissue: Callus, score: 96.201 N N N N
vg0105135246 CTAGTA -> TTAGTA LOC_Os01g09890.1 downstream_gene_variant ; 3217.0bp to feature; MODIFIER silent_mutation Average:77.946; most accessible tissue: Callus, score: 96.201 N N N N
vg0105135246 CTAGTA -> TTAGTA LOC_Os01g09880-LOC_Os01g09890 intergenic_region ; MODIFIER silent_mutation Average:77.946; most accessible tissue: Callus, score: 96.201 N N N N
vg0105135246 CTAGTA -> DEL N N silent_mutation Average:77.946; most accessible tissue: Callus, score: 96.201 N N N N
vg0105135246 CTAGTA -> C LOC_Os01g09880.1 upstream_gene_variant ; 2329.0bp to feature; MODIFIER silent_mutation Average:77.946; most accessible tissue: Callus, score: 96.201 N N N N
vg0105135246 CTAGTA -> C LOC_Os01g09890.1 downstream_gene_variant ; 3216.0bp to feature; MODIFIER silent_mutation Average:77.946; most accessible tissue: Callus, score: 96.201 N N N N
vg0105135246 CTAGTA -> C LOC_Os01g09880-LOC_Os01g09890 intergenic_region ; MODIFIER silent_mutation Average:77.946; most accessible tissue: Callus, score: 96.201 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0105135246 CTAGT* ATAGT* 0.2 -0.02 -0.03 -0.1 -0.09 -0.06
vg0105135246 CTAGT* C -0.06 -0.06 -0.06 -0.34 -0.23 -0.04
vg0105135246 CTAGT* TTAGT* 0.09 -0.02 -0.02 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105135246 3.37E-25 1.46E-27 mr1057 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105135246 1.19E-14 1.36E-20 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105135246 9.33E-07 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105135246 NA 2.93E-06 mr1677 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105135246 6.75E-06 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105135246 1.09E-34 2.33E-40 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105135246 2.81E-18 1.41E-23 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105135246 6.92E-07 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105135246 6.60E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105135246 4.00E-07 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251