Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105133448:

Variant ID: vg0105133448 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5133448
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

GGGAGTACTTTTTAGTACAAATCTAGGTGCAACCTCCATACAACGCTAAATTAAGTATGTTTAGACGGTTTTTGGTTGTGATACTAATGCCTTTAATCGT[T/C]
TTAGTTTATTTTCATCAGATTACTGAAATGAATTTCTTTCCTCCATACTTAAAAAAAAAAAAAAACTTCGACCGCTACATAGACCGTATACCACCTATTT

Reverse complement sequence

AAATAGGTGGTATACGGTCTATGTAGCGGTCGAAGTTTTTTTTTTTTTTTAAGTATGGAGGAAAGAAATTCATTTCAGTAATCTGATGAAAATAAACTAA[A/G]
ACGATTAAAGGCATTAGTATCACAACCAAAAACCGTCTAAACATACTTAATTTAGCGTTGTATGGAGGTTGCACCTAGATTTGTACTAAAAAGTACTCCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.50%	45.00%	0.55%	0.00%	NA
All Indica	2759	30.10%	69.20%	0.69%	0.00%	NA
All Japonica	1512	98.90%	1.00%	0.07%	0.00%	NA
Aus	269	48.30%	50.20%	1.49%	0.00%	NA
Indica I	595	72.90%	26.60%	0.50%	0.00%	NA
Indica II	465	22.60%	77.40%	0.00%	0.00%	NA
Indica III	913	3.40%	96.40%	0.22%	0.00%	NA
Indica Intermediate	786	33.10%	65.10%	1.78%	0.00%	NA
Temperate Japonica	767	98.70%	1.20%	0.13%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	75.00%	25.00%	0.00%	0.00%	NA
Intermediate	90	51.10%	46.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105133448	T -> C	LOC_Os01g09870.1	upstream_gene_variant ; 4781.0bp to feature; MODIFIER	silent_mutation	Average:46.557; most accessible tissue: Callus, score: 87.689	N	N	N	N
vg0105133448	T -> C	LOC_Os01g09880.1	upstream_gene_variant ; 530.0bp to feature; MODIFIER	silent_mutation	Average:46.557; most accessible tissue: Callus, score: 87.689	N	N	N	N
vg0105133448	T -> C	LOC_Os01g09880-LOC_Os01g09890	intergenic_region ; MODIFIER	silent_mutation	Average:46.557; most accessible tissue: Callus, score: 87.689	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105133448	NA	8.74E-13	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105133448	NA	7.95E-06	mr1261	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105133448	6.20E-06	NA	mr1375	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105133448	3.37E-06	3.63E-06	mr1500	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105133448	NA	4.32E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105133448	2.41E-06	1.09E-15	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105133448	4.09E-06	4.09E-06	mr1916	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105133448	NA	3.04E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105133448	NA	1.82E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105133448	NA	9.33E-09	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251