\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105082156:

Variant ID: vg0105082156 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5082156
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTATAATTTGGTTATTACAAATCTTATAATATATGAAAAATTATAAGCTAAGGATTAATTTTGTAAACCATACCAAGTTTGATCGTGCCTTATATTAT[G/A]
GAATAGTGAGAGTACAACCCACCACATATAAAATTCCCATCGACTCGTATTCCTAATTAAGATCATGATCCTTGAGTTATTTTTTAATGGAAATATAACT

Reverse complement sequence

AGTTATATTTCCATTAAAAAATAACTCAAGGATCATGATCTTAATTAGGAATACGAGTCGATGGGAATTTTATATGTGGTGGGTTGTACTCTCACTATTC[C/T]
ATAATATAAGGCACGATCAAACTTGGTATGGTTTACAAAATTAATCCTTAGCTTATAATTTTTCATATATTATAAGATTTGTAATAACCAAATTATAACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.70% 17.10% 0.17% 0.00% NA
All Indica  2759 76.70% 23.10% 0.25% 0.00% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 42.80% 56.90% 0.37% 0.00% NA
Indica I  595 27.60% 72.30% 0.17% 0.00% NA
Indica II  465 97.40% 2.40% 0.22% 0.00% NA
Indica III  913 97.70% 2.20% 0.11% 0.00% NA
Indica Intermediate  786 77.20% 22.30% 0.51% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105082156 G -> A LOC_Os01g09830.1 upstream_gene_variant ; 3677.0bp to feature; MODIFIER silent_mutation Average:45.881; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0105082156 G -> A LOC_Os01g09810-LOC_Os01g09830 intergenic_region ; MODIFIER silent_mutation Average:45.881; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105082156 NA 8.70E-08 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156 NA 3.52E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156 NA 6.75E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156 NA 9.45E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156 NA 4.72E-12 mr1482_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156 NA 4.52E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156 NA 4.20E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156 NA 3.89E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105082156 NA 9.33E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251