\
| Variant ID: vg0105082156 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5082156 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 123. )
GGTTATAATTTGGTTATTACAAATCTTATAATATATGAAAAATTATAAGCTAAGGATTAATTTTGTAAACCATACCAAGTTTGATCGTGCCTTATATTAT[G/A]
GAATAGTGAGAGTACAACCCACCACATATAAAATTCCCATCGACTCGTATTCCTAATTAAGATCATGATCCTTGAGTTATTTTTTAATGGAAATATAACT
AGTTATATTTCCATTAAAAAATAACTCAAGGATCATGATCTTAATTAGGAATACGAGTCGATGGGAATTTTATATGTGGTGGGTTGTACTCTCACTATTC[C/T]
ATAATATAAGGCACGATCAAACTTGGTATGGTTTACAAAATTAATCCTTAGCTTATAATTTTTCATATATTATAAGATTTGTAATAACCAAATTATAACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.70% | 17.10% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 76.70% | 23.10% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 42.80% | 56.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 27.60% | 72.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.70% | 2.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 77.20% | 22.30% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105082156 | G -> A | LOC_Os01g09830.1 | upstream_gene_variant ; 3677.0bp to feature; MODIFIER | silent_mutation | Average:45.881; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0105082156 | G -> A | LOC_Os01g09810-LOC_Os01g09830 | intergenic_region ; MODIFIER | silent_mutation | Average:45.881; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105082156 | NA | 8.70E-08 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105082156 | NA | 3.52E-06 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105082156 | NA | 6.75E-07 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105082156 | NA | 9.45E-06 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105082156 | NA | 4.72E-12 | mr1482_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105082156 | NA | 4.52E-07 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105082156 | NA | 4.20E-09 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105082156 | NA | 3.89E-09 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105082156 | NA | 9.33E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |