\
| Variant ID: vg0105042933 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5042933 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGAAAGTATATTTAACAATAAATCAAATGATAAAAAAGAATAAATAATTACTTAAATTTTTTGAATAAGACGAACGGTCAAATATTTTTAAAAAAGTCAA[C/T]
GGTGTCAAATATTTTGGGACGGAGAGAGTATATAAATAGGCAGATGGACAACATAGTACATGAAGAGATCGAAACAGCGTAACACGCTAGCTATCTTGTA
TACAAGATAGCTAGCGTGTTACGCTGTTTCGATCTCTTCATGTACTATGTTGTCCATCTGCCTATTTATATACTCTCTCCGTCCCAAAATATTTGACACC[G/A]
TTGACTTTTTTAAAAATATTTGACCGTTCGTCTTATTCAAAAAATTTAAGTAATTATTTATTCTTTTTTATCATTTGATTTATTGTTAAATATACTTTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.00% | 0.20% | 2.35% | 63.48% | NA |
| All Indica | 2759 | 1.60% | 0.30% | 2.10% | 96.09% | NA |
| All Japonica | 1512 | 98.10% | 0.10% | 0.00% | 1.85% | NA |
| Aus | 269 | 1.90% | 0.00% | 14.50% | 83.64% | NA |
| Indica I | 595 | 0.20% | 0.00% | 4.54% | 95.29% | NA |
| Indica II | 465 | 3.90% | 0.00% | 0.22% | 95.91% | NA |
| Indica III | 913 | 1.00% | 0.50% | 0.33% | 98.14% | NA |
| Indica Intermediate | 786 | 1.90% | 0.30% | 3.44% | 94.40% | NA |
| Temperate Japonica | 767 | 98.80% | 0.00% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 97.00% | 0.00% | 0.00% | 2.98% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.40% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 38.50% | 0.00% | 10.42% | 51.04% | NA |
| Intermediate | 90 | 43.30% | 0.00% | 4.44% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105042933 | C -> T | LOC_Os01g09770.1 | upstream_gene_variant ; 2235.0bp to feature; MODIFIER | silent_mutation | Average:66.173; most accessible tissue: Callus, score: 88.417 | N | N | N | N |
| vg0105042933 | C -> T | LOC_Os01g09770-LOC_Os01g09790 | intergenic_region ; MODIFIER | silent_mutation | Average:66.173; most accessible tissue: Callus, score: 88.417 | N | N | N | N |
| vg0105042933 | C -> DEL | N | N | silent_mutation | Average:66.173; most accessible tissue: Callus, score: 88.417 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105042933 | NA | 8.67E-07 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105042933 | 6.52E-06 | NA | mr1375 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105042933 | NA | 1.29E-07 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105042933 | NA | 6.91E-07 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105042933 | NA | 1.83E-08 | mr1745 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105042933 | NA | 1.39E-06 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105042933 | NA | 5.67E-09 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105042933 | NA | 8.93E-08 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105042933 | NA | 9.13E-06 | mr1659_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |