\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105042933:

Variant ID: vg0105042933 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5042933
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAAGTATATTTAACAATAAATCAAATGATAAAAAAGAATAAATAATTACTTAAATTTTTTGAATAAGACGAACGGTCAAATATTTTTAAAAAAGTCAA[C/T]
GGTGTCAAATATTTTGGGACGGAGAGAGTATATAAATAGGCAGATGGACAACATAGTACATGAAGAGATCGAAACAGCGTAACACGCTAGCTATCTTGTA

Reverse complement sequence

TACAAGATAGCTAGCGTGTTACGCTGTTTCGATCTCTTCATGTACTATGTTGTCCATCTGCCTATTTATATACTCTCTCCGTCCCAAAATATTTGACACC[G/A]
TTGACTTTTTTAAAAATATTTGACCGTTCGTCTTATTCAAAAAATTTAAGTAATTATTTATTCTTTTTTATCATTTGATTTATTGTTAAATATACTTTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.00% 0.20% 2.35% 63.48% NA
All Indica  2759 1.60% 0.30% 2.10% 96.09% NA
All Japonica  1512 98.10% 0.10% 0.00% 1.85% NA
Aus  269 1.90% 0.00% 14.50% 83.64% NA
Indica I  595 0.20% 0.00% 4.54% 95.29% NA
Indica II  465 3.90% 0.00% 0.22% 95.91% NA
Indica III  913 1.00% 0.50% 0.33% 98.14% NA
Indica Intermediate  786 1.90% 0.30% 3.44% 94.40% NA
Temperate Japonica  767 98.80% 0.00% 0.00% 1.17% NA
Tropical Japonica  504 97.00% 0.00% 0.00% 2.98% NA
Japonica Intermediate  241 97.90% 0.40% 0.00% 1.66% NA
VI/Aromatic  96 38.50% 0.00% 10.42% 51.04% NA
Intermediate  90 43.30% 0.00% 4.44% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105042933 C -> T LOC_Os01g09770.1 upstream_gene_variant ; 2235.0bp to feature; MODIFIER silent_mutation Average:66.173; most accessible tissue: Callus, score: 88.417 N N N N
vg0105042933 C -> T LOC_Os01g09770-LOC_Os01g09790 intergenic_region ; MODIFIER silent_mutation Average:66.173; most accessible tissue: Callus, score: 88.417 N N N N
vg0105042933 C -> DEL N N silent_mutation Average:66.173; most accessible tissue: Callus, score: 88.417 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105042933 NA 8.67E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933 6.52E-06 NA mr1375 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933 NA 1.29E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933 NA 6.91E-07 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933 NA 1.83E-08 mr1745 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933 NA 1.39E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933 NA 5.67E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933 NA 8.93E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105042933 NA 9.13E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251