\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105021483:

Variant ID: vg0105021483 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5021483
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


GGATGAGGAACTACATCAACTTTGGTAGTTTGGTTGCCTCTTCCCATCTGCTTGTTCTTTAAGAGAACCTCTCTTCTCTTCCGCATGAGATATGTCAATT[G/C]
AAGAACTCATTCAGCTAAGCTGCGTCCTCCACAACTATAAAACCCAATGTGGGAGTTTCAGTAAATGAATACTCTATATCTTGTAAAAACACCAACAACA

Reverse complement sequence

TGTTGTTGGTGTTTTTACAAGATATAGAGTATTCATTTACTGAAACTCCCACATTGGGTTTTATAGTTGTGGAGGACGCAGCTTAGCTGAATGAGTTCTT[C/G]
AATTGACATATCTCATGCGGAAGAGAAGAGAGGTTCTCTTAAAGAACAAGCAGATGGGAAGAGGCAACCAAACTACCAAAGTTGATGTAGTTCCTCATCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 6.20% 0.40% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 80.70% 18.10% 1.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 67.50% 30.10% 2.35% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 82.60% 17.00% 0.41% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105021483 G -> C LOC_Os01g09750.1 3_prime_UTR_variant ; 676.0bp to feature; MODIFIER silent_mutation Average:52.538; most accessible tissue: Callus, score: 89.297 N N N N
vg0105021483 G -> C LOC_Os01g09740.1 upstream_gene_variant ; 1333.0bp to feature; MODIFIER silent_mutation Average:52.538; most accessible tissue: Callus, score: 89.297 N N N N
vg0105021483 G -> C LOC_Os01g09730.1 downstream_gene_variant ; 2831.0bp to feature; MODIFIER silent_mutation Average:52.538; most accessible tissue: Callus, score: 89.297 N N N N
vg0105021483 G -> C LOC_Os01g09730.2 downstream_gene_variant ; 3594.0bp to feature; MODIFIER silent_mutation Average:52.538; most accessible tissue: Callus, score: 89.297 N N N N
vg0105021483 G -> C LOC_Os01g09750.2 downstream_gene_variant ; 568.0bp to feature; MODIFIER silent_mutation Average:52.538; most accessible tissue: Callus, score: 89.297 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105021483 NA 7.83E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105021483 NA 5.13E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105021483 NA 1.03E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105021483 4.22E-06 4.22E-06 mr1036_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105021483 2.85E-09 1.16E-12 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105021483 NA 5.51E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105021483 NA 5.33E-10 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105021483 NA 3.41E-06 mr1923_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251