| Variant ID: vg0105021483 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5021483 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )
GGATGAGGAACTACATCAACTTTGGTAGTTTGGTTGCCTCTTCCCATCTGCTTGTTCTTTAAGAGAACCTCTCTTCTCTTCCGCATGAGATATGTCAATT[G/C]
AAGAACTCATTCAGCTAAGCTGCGTCCTCCACAACTATAAAACCCAATGTGGGAGTTTCAGTAAATGAATACTCTATATCTTGTAAAAACACCAACAACA
TGTTGTTGGTGTTTTTACAAGATATAGAGTATTCATTTACTGAAACTCCCACATTGGGTTTTATAGTTGTGGAGGACGCAGCTTAGCTGAATGAGTTCTT[C/G]
AATTGACATATCTCATGCGGAAGAGAAGAGAGGTTCTCTTAAAGAACAAGCAGATGGGAAGAGGCAACCAAACTACCAAAGTTGATGTAGTTCCTCATCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.40% | 6.20% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 80.70% | 18.10% | 1.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 67.50% | 30.10% | 2.35% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.60% | 17.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105021483 | G -> C | LOC_Os01g09750.1 | 3_prime_UTR_variant ; 676.0bp to feature; MODIFIER | silent_mutation | Average:52.538; most accessible tissue: Callus, score: 89.297 | N | N | N | N |
| vg0105021483 | G -> C | LOC_Os01g09740.1 | upstream_gene_variant ; 1333.0bp to feature; MODIFIER | silent_mutation | Average:52.538; most accessible tissue: Callus, score: 89.297 | N | N | N | N |
| vg0105021483 | G -> C | LOC_Os01g09730.1 | downstream_gene_variant ; 2831.0bp to feature; MODIFIER | silent_mutation | Average:52.538; most accessible tissue: Callus, score: 89.297 | N | N | N | N |
| vg0105021483 | G -> C | LOC_Os01g09730.2 | downstream_gene_variant ; 3594.0bp to feature; MODIFIER | silent_mutation | Average:52.538; most accessible tissue: Callus, score: 89.297 | N | N | N | N |
| vg0105021483 | G -> C | LOC_Os01g09750.2 | downstream_gene_variant ; 568.0bp to feature; MODIFIER | silent_mutation | Average:52.538; most accessible tissue: Callus, score: 89.297 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105021483 | NA | 7.83E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105021483 | NA | 5.13E-07 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105021483 | NA | 1.03E-07 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105021483 | 4.22E-06 | 4.22E-06 | mr1036_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105021483 | 2.85E-09 | 1.16E-12 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105021483 | NA | 5.51E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105021483 | NA | 5.33E-10 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105021483 | NA | 3.41E-06 | mr1923_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |