\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105008879:

Variant ID: vg0105008879 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5008879
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCAGCTGCAGTAAACATCGTAATAATATTTACTGTAATTTTTTATTTATAGATAACGGAATGGAACCTACCGTGAAAGCAGACGGTCAAAAAAGAAAAC[C/G]
AGAGAGAAACGTGTCACAATACAAACAGTATCAGGGTCTCATCGGATGGTTTGTTTGGCTGAGGCTTGGGCTTAGGCTTTTCAGCCAACACAGAGGGGCC

Reverse complement sequence

GGCCCCTCTGTGTTGGCTGAAAAGCCTAAGCCCAAGCCTCAGCCAAACAAACCATCCGATGAGACCCTGATACTGTTTGTATTGTGACACGTTTCTCTCT[G/C]
GTTTTCTTTTTTGACCGTCTGCTTTCACGGTAGGTTCCATTCCGTTATCTATAAATAAAAAATTACAGTAAATATTATTACGATGTTTACTGCAGCTGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.80% 23.70% 0.51% 0.00% NA
All Indica  2759 98.60% 1.40% 0.00% 0.00% NA
All Japonica  1512 30.40% 68.20% 1.46% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 35.10% 63.10% 1.83% 0.00% NA
Tropical Japonica  504 13.30% 85.70% 0.99% 0.00% NA
Japonica Intermediate  241 51.00% 47.70% 1.24% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 75.60% 22.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105008879 C -> G LOC_Os01g09700.1 upstream_gene_variant ; 3152.0bp to feature; MODIFIER silent_mutation Average:91.334; most accessible tissue: Minghui63 young leaf, score: 95.826 N N N N
vg0105008879 C -> G LOC_Os01g09710.1 upstream_gene_variant ; 1169.0bp to feature; MODIFIER silent_mutation Average:91.334; most accessible tissue: Minghui63 young leaf, score: 95.826 N N N N
vg0105008879 C -> G LOC_Os01g09700-LOC_Os01g09710 intergenic_region ; MODIFIER silent_mutation Average:91.334; most accessible tissue: Minghui63 young leaf, score: 95.826 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0105008879 C G 0.03 0.06 0.04 0.03 0.04 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105008879 NA 6.42E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105008879 NA 1.10E-16 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105008879 NA 3.20E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105008879 7.53E-07 NA mr1765 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105008879 NA 2.96E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105008879 NA 6.85E-16 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105008879 NA 6.60E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105008879 NA 5.49E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251