\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105005584:

Variant ID: vg0105005584 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 5005584
Reference Allele: AAlternative Allele: AT,T,AAT
Primary Allele: ATSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACCTTCCATTCATAAATATAACGTGGTTTACACATAATGTCAATAACCAAATTTTAACTTAAACATCAGATACTTATGACTGAAAGAAAAGAAAAAAA[A/AT,T,AAT]
TCTCTTTAATAAAATTTATGTCTCGTGCAGAATACAATACGATTTCATCTTTCGTTTCATCAGAAAAAATCTGGGACGGAAGGATTCGAACCTCCGAGTA

Reverse complement sequence

TACTCGGAGGTTCGAATCCTTCCGTCCCAGATTTTTTCTGATGAAACGAAAGATGAAATCGTATTGTATTCTGCACGAGACATAAATTTTATTAAAGAGA[T/AT,A,ATT]
TTTTTTTCTTTTCTTTCAGTCATAAGTATCTGATGTTTAAGTTAAAATTTGGTTATTGACATTATGTGTAAACCACGTTATATTTATGAATGGAAGGTTT

Allele Frequencies:

Populations Population SizeFrequency of AT(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 27.10% 1.67% 0.00% A: 5.56%; AAT: 0.06%
All Indica  2759 97.80% 1.30% 0.33% 0.00% A: 0.54%; AAT: 0.11%
All Japonica  1512 1.90% 78.20% 3.84% 0.00% A: 16.07%
Aus  269 93.70% 4.80% 1.49% 0.00% NA
Indica I  595 99.20% 0.00% 0.67% 0.00% AAT: 0.17%
Indica II  465 95.90% 1.10% 0.22% 0.00% A: 2.80%
Indica III  913 97.80% 2.00% 0.00% 0.00% AAT: 0.22%
Indica Intermediate  786 97.70% 1.50% 0.51% 0.00% A: 0.25%
Temperate Japonica  767 1.30% 64.00% 7.17% 0.00% A: 27.51%
Tropical Japonica  504 2.80% 96.40% 0.20% 0.00% A: 0.60%
Japonica Intermediate  241 1.70% 85.50% 0.83% 0.00% A: 12.03%
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 60.00% 25.60% 8.89% 0.00% A: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105005584 A -> T LOC_Os01g09710.1 upstream_gene_variant ; 4464.0bp to feature; MODIFIER silent_mutation Average:28.808; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0105005584 A -> T LOC_Os01g09700.1 intron_variant ; MODIFIER silent_mutation Average:28.808; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0105005584 A -> AT LOC_Os01g09710.1 upstream_gene_variant ; 4463.0bp to feature; MODIFIER silent_mutation Average:28.808; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0105005584 A -> AT LOC_Os01g09700.1 intron_variant ; MODIFIER silent_mutation Average:28.808; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0105005584 A -> AAT LOC_Os01g09710.1 upstream_gene_variant ; 4463.0bp to feature; MODIFIER silent_mutation Average:28.808; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0105005584 A -> AAT LOC_Os01g09700.1 intron_variant ; MODIFIER silent_mutation Average:28.808; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105005584 NA 3.14E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 8.99E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 3.47E-13 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 1.25E-10 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 1.56E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 1.49E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 3.12E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 5.99E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 7.35E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 3.41E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 4.71E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 4.86E-21 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 2.03E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 2.96E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 3.10E-28 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 2.50E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 3.55E-06 2.28E-07 mr1773 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 8.04E-13 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 1.57E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 1.15E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 1.37E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 1.37E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 2.57E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 2.45E-08 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 7.37E-07 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 2.62E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105005584 NA 8.88E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251