\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104989336:

Variant ID: vg0104989336 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4989336
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TAATAGACGACGCCGTTAACTTCTTACATGTTTGACCATTCGTCTTATTCAAAAAATTTACATAATTATAATTTGTTTTGTTATGAGTTGTTTTATTACT[C/T]
ATAGTACTTTAAGTGTGATTTATATCTTATACATTTGCATAATTTTTTTAATAAGACGAATGGTTAAACATGTGAGAAAAAGTCGACGGCGTCATCTATT

Reverse complement sequence

AATAGATGACGCCGTCGACTTTTTCTCACATGTTTAACCATTCGTCTTATTAAAAAAATTATGCAAATGTATAAGATATAAATCACACTTAAAGTACTAT[G/A]
AGTAATAAAACAACTCATAACAAAACAAATTATAATTATGTAAATTTTTTGAATAAGACGAATGGTCAAACATGTAAGAAGTTAACGGCGTCGTCTATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 15.70% 6.45% 6.22% NA
All Indica  2759 60.30% 19.20% 10.40% 10.08% NA
All Japonica  1512 98.90% 1.00% 0.07% 0.00% NA
Aus  269 33.10% 60.20% 2.97% 3.72% NA
Indica I  595 33.30% 56.30% 9.08% 1.34% NA
Indica II  465 77.00% 3.40% 10.11% 9.46% NA
Indica III  913 67.80% 3.10% 10.62% 18.51% NA
Indica Intermediate  786 62.10% 19.30% 11.32% 7.25% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 62.50% 25.00% 7.29% 5.21% NA
Intermediate  90 83.30% 13.30% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104989336 C -> T LOC_Os01g09670.1 upstream_gene_variant ; 4193.0bp to feature; MODIFIER silent_mutation Average:81.301; most accessible tissue: Minghui63 root, score: 97.207 N N N N
vg0104989336 C -> T LOC_Os01g09680.1 upstream_gene_variant ; 1135.0bp to feature; MODIFIER silent_mutation Average:81.301; most accessible tissue: Minghui63 root, score: 97.207 N N N N
vg0104989336 C -> T LOC_Os01g09690.1 upstream_gene_variant ; 2177.0bp to feature; MODIFIER silent_mutation Average:81.301; most accessible tissue: Minghui63 root, score: 97.207 N N N N
vg0104989336 C -> T LOC_Os01g09680-LOC_Os01g09690 intergenic_region ; MODIFIER silent_mutation Average:81.301; most accessible tissue: Minghui63 root, score: 97.207 N N N N
vg0104989336 C -> DEL N N silent_mutation Average:81.301; most accessible tissue: Minghui63 root, score: 97.207 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0104989336 C T 0.01 0.0 0.0 -0.01 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104989336 NA 2.05E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336 NA 4.72E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336 NA 1.38E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336 NA 1.49E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336 NA 4.38E-06 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336 NA 4.36E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336 NA 3.25E-06 mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336 NA 2.47E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336 NA 3.14E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336 NA 8.25E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336 NA 2.68E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336 NA 1.19E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336 2.40E-08 8.37E-22 mr1587_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336 2.79E-06 NA mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251