Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0104989336:

Variant ID: vg0104989336 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 4989336
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TAATAGACGACGCCGTTAACTTCTTACATGTTTGACCATTCGTCTTATTCAAAAAATTTACATAATTATAATTTGTTTTGTTATGAGTTGTTTTATTACT[C/T]
ATAGTACTTTAAGTGTGATTTATATCTTATACATTTGCATAATTTTTTTAATAAGACGAATGGTTAAACATGTGAGAAAAAGTCGACGGCGTCATCTATT

Reverse complement sequence

AATAGATGACGCCGTCGACTTTTTCTCACATGTTTAACCATTCGTCTTATTAAAAAAATTATGCAAATGTATAAGATATAAATCACACTTAAAGTACTAT[G/A]
AGTAATAAAACAACTCATAACAAAACAAATTATAATTATGTAAATTTTTTGAATAAGACGAATGGTCAAACATGTAAGAAGTTAACGGCGTCGTCTATTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	15.70%	6.45%	6.22%	NA
All Indica	2759	60.30%	19.20%	10.40%	10.08%	NA
All Japonica	1512	98.90%	1.00%	0.07%	0.00%	NA
Aus	269	33.10%	60.20%	2.97%	3.72%	NA
Indica I	595	33.30%	56.30%	9.08%	1.34%	NA
Indica II	465	77.00%	3.40%	10.11%	9.46%	NA
Indica III	913	67.80%	3.10%	10.62%	18.51%	NA
Indica Intermediate	786	62.10%	19.30%	11.32%	7.25%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	97.80%	2.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	62.50%	25.00%	7.29%	5.21%	NA
Intermediate	90	83.30%	13.30%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0104989336	C -> T	LOC_Os01g09670.1	upstream_gene_variant ; 4193.0bp to feature; MODIFIER	silent_mutation	Average:81.301; most accessible tissue: Minghui63 root, score: 97.207	N	N	N	N
vg0104989336	C -> T	LOC_Os01g09680.1	upstream_gene_variant ; 1135.0bp to feature; MODIFIER	silent_mutation	Average:81.301; most accessible tissue: Minghui63 root, score: 97.207	N	N	N	N
vg0104989336	C -> T	LOC_Os01g09690.1	upstream_gene_variant ; 2177.0bp to feature; MODIFIER	silent_mutation	Average:81.301; most accessible tissue: Minghui63 root, score: 97.207	N	N	N	N
vg0104989336	C -> T	LOC_Os01g09680-LOC_Os01g09690	intergenic_region ; MODIFIER	silent_mutation	Average:81.301; most accessible tissue: Minghui63 root, score: 97.207	N	N	N	N
vg0104989336	C -> DEL	N	N	silent_mutation	Average:81.301; most accessible tissue: Minghui63 root, score: 97.207	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0104989336	C	T	0.01	0.0	0.0	-0.01	0.0	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0104989336	NA	2.05E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336	NA	4.72E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336	NA	1.38E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336	NA	1.49E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336	NA	4.38E-06	mr1485	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336	NA	4.36E-07	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336	NA	3.25E-06	mr1651	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336	NA	2.47E-07	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336	NA	3.14E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336	NA	8.25E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336	NA	2.68E-14	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336	NA	1.19E-11	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336	2.40E-08	8.37E-22	mr1587_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104989336	2.79E-06	NA	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251