RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0104923119:

Variant ID: vg0104923119 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 4923119
Reference Allele: G	Alternative Allele: GA,A
Primary Allele: G	Secondary Allele: GA

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.52, G: 0.49, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTCTTAGAATTTATAGGATTTTCTCTATTTTATTAGAGCGCCACGTGGCGGTTTGAGAGCGTTTGTAGAAAGTTTCATGGACTTTTAGTATATAATAG[G/GA,A]
TAGATAGATAGATGGATGCATATGTCCGGTTGAATGTACAAGCCGAGTAAAAAATACCCTTCTCTAAAAAAATAAAAAAAAGTTTGGCTCATGATGATTA

Reverse complement sequence

TAATCATCATGAGCCAAACTTTTTTTTATTTTTTTAGAGAAGGGTATTTTTTACTCGGCTTGTACATTCAACCGGACATATGCATCCATCTATCTATCTA[C/TC,T]
CTATTATATACTAAAAGTCCATGAAACTTTCTACAAACGCTCTCAAACCGCCACGTGGCGCTCTAATAAAATAGAGAAAATCCTATAAATTCTAAGAAAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of GA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.30%	39.20%	0.42%	0.00%	A: 4.08%
All Indica	2759	38.10%	60.40%	0.51%	0.00%	A: 1.01%
All Japonica	1512	96.40%	0.80%	0.07%	0.00%	A: 2.71%
Aus	269	31.60%	33.50%	0.37%	0.00%	A: 34.57%
Indica I	595	85.50%	14.10%	0.34%	0.00%	NA
Indica II	465	25.20%	73.80%	0.43%	0.00%	A: 0.65%
Indica III	913	6.90%	91.70%	0.00%	0.00%	A: 1.42%
Indica Intermediate	786	45.90%	51.30%	1.27%	0.00%	A: 1.53%
Temperate Japonica	767	99.00%	0.70%	0.00%	0.00%	A: 0.39%
Tropical Japonica	504	94.60%	1.00%	0.20%	0.00%	A: 4.17%
Japonica Intermediate	241	92.10%	0.80%	0.00%	0.00%	A: 7.05%
VI/Aromatic	96	30.20%	45.80%	1.04%	0.00%	A: 22.92%
Intermediate	90	44.40%	42.20%	3.33%	0.00%	A: 10.00%

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0104923119	G -> A	LOC_Os01g09590.1	upstream_gene_variant ; 3895.0bp to feature; MODIFIER	silent_mutation	Average:66.0; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N
vg0104923119	G -> A	LOC_Os01g09590-LOC_Os01g09600	intergenic_region ; MODIFIER	silent_mutation	Average:66.0; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N
vg0104923119	G -> GA	LOC_Os01g09590.1	upstream_gene_variant ; 3896.0bp to feature; MODIFIER	silent_mutation	Average:66.0; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N
vg0104923119	G -> GA	LOC_Os01g09590-LOC_Os01g09600	intergenic_region ; MODIFIER	silent_mutation	Average:66.0; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0104923119	2.09E-06	NA	mr1240	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104923119	NA	1.07E-07	mr1312	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104923119	NA	2.63E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104923119	NA	5.98E-08	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104923119	2.17E-07	NA	mr1495	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104923119	NA	7.34E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104923119	NA	8.47E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 7 of 7 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0104923119:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact