\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104923119:

Variant ID: vg0104923119 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 4923119
Reference Allele: GAlternative Allele: GA,A
Primary Allele: GSecondary Allele: GA

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.52, G: 0.49, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTCTTAGAATTTATAGGATTTTCTCTATTTTATTAGAGCGCCACGTGGCGGTTTGAGAGCGTTTGTAGAAAGTTTCATGGACTTTTAGTATATAATAG[G/GA,A]
TAGATAGATAGATGGATGCATATGTCCGGTTGAATGTACAAGCCGAGTAAAAAATACCCTTCTCTAAAAAAATAAAAAAAAGTTTGGCTCATGATGATTA

Reverse complement sequence

TAATCATCATGAGCCAAACTTTTTTTTATTTTTTTAGAGAAGGGTATTTTTTACTCGGCTTGTACATTCAACCGGACATATGCATCCATCTATCTATCTA[C/TC,T]
CTATTATATACTAAAAGTCCATGAAACTTTCTACAAACGCTCTCAAACCGCCACGTGGCGCTCTAATAAAATAGAGAAAATCCTATAAATTCTAAGAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of GA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 39.20% 0.42% 0.00% A: 4.08%
All Indica  2759 38.10% 60.40% 0.51% 0.00% A: 1.01%
All Japonica  1512 96.40% 0.80% 0.07% 0.00% A: 2.71%
Aus  269 31.60% 33.50% 0.37% 0.00% A: 34.57%
Indica I  595 85.50% 14.10% 0.34% 0.00% NA
Indica II  465 25.20% 73.80% 0.43% 0.00% A: 0.65%
Indica III  913 6.90% 91.70% 0.00% 0.00% A: 1.42%
Indica Intermediate  786 45.90% 51.30% 1.27% 0.00% A: 1.53%
Temperate Japonica  767 99.00% 0.70% 0.00% 0.00% A: 0.39%
Tropical Japonica  504 94.60% 1.00% 0.20% 0.00% A: 4.17%
Japonica Intermediate  241 92.10% 0.80% 0.00% 0.00% A: 7.05%
VI/Aromatic  96 30.20% 45.80% 1.04% 0.00% A: 22.92%
Intermediate  90 44.40% 42.20% 3.33% 0.00% A: 10.00%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104923119 G -> A LOC_Os01g09590.1 upstream_gene_variant ; 3895.0bp to feature; MODIFIER silent_mutation Average:66.0; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg0104923119 G -> A LOC_Os01g09590-LOC_Os01g09600 intergenic_region ; MODIFIER silent_mutation Average:66.0; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg0104923119 G -> GA LOC_Os01g09590.1 upstream_gene_variant ; 3896.0bp to feature; MODIFIER silent_mutation Average:66.0; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg0104923119 G -> GA LOC_Os01g09590-LOC_Os01g09600 intergenic_region ; MODIFIER silent_mutation Average:66.0; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104923119 2.09E-06 NA mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104923119 NA 1.07E-07 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104923119 NA 2.63E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104923119 NA 5.98E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104923119 2.17E-07 NA mr1495 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104923119 NA 7.34E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104923119 NA 8.47E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251