\
| Variant ID: vg0104923119 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 4923119 |
| Reference Allele: G | Alternative Allele: GA,A |
| Primary Allele: G | Secondary Allele: GA |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.52, G: 0.49, others allele: 0.00, population size: 99. )
TTTTCTTAGAATTTATAGGATTTTCTCTATTTTATTAGAGCGCCACGTGGCGGTTTGAGAGCGTTTGTAGAAAGTTTCATGGACTTTTAGTATATAATAG[G/GA,A]
TAGATAGATAGATGGATGCATATGTCCGGTTGAATGTACAAGCCGAGTAAAAAATACCCTTCTCTAAAAAAATAAAAAAAAGTTTGGCTCATGATGATTA
TAATCATCATGAGCCAAACTTTTTTTTATTTTTTTAGAGAAGGGTATTTTTTACTCGGCTTGTACATTCAACCGGACATATGCATCCATCTATCTATCTA[C/TC,T]
CTATTATATACTAAAAGTCCATGAAACTTTCTACAAACGCTCTCAAACCGCCACGTGGCGCTCTAATAAAATAGAGAAAATCCTATAAATTCTAAGAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of GA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.30% | 39.20% | 0.42% | 0.00% | A: 4.08% |
| All Indica | 2759 | 38.10% | 60.40% | 0.51% | 0.00% | A: 1.01% |
| All Japonica | 1512 | 96.40% | 0.80% | 0.07% | 0.00% | A: 2.71% |
| Aus | 269 | 31.60% | 33.50% | 0.37% | 0.00% | A: 34.57% |
| Indica I | 595 | 85.50% | 14.10% | 0.34% | 0.00% | NA |
| Indica II | 465 | 25.20% | 73.80% | 0.43% | 0.00% | A: 0.65% |
| Indica III | 913 | 6.90% | 91.70% | 0.00% | 0.00% | A: 1.42% |
| Indica Intermediate | 786 | 45.90% | 51.30% | 1.27% | 0.00% | A: 1.53% |
| Temperate Japonica | 767 | 99.00% | 0.70% | 0.00% | 0.00% | A: 0.39% |
| Tropical Japonica | 504 | 94.60% | 1.00% | 0.20% | 0.00% | A: 4.17% |
| Japonica Intermediate | 241 | 92.10% | 0.80% | 0.00% | 0.00% | A: 7.05% |
| VI/Aromatic | 96 | 30.20% | 45.80% | 1.04% | 0.00% | A: 22.92% |
| Intermediate | 90 | 44.40% | 42.20% | 3.33% | 0.00% | A: 10.00% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0104923119 | G -> A | LOC_Os01g09590.1 | upstream_gene_variant ; 3895.0bp to feature; MODIFIER | silent_mutation | Average:66.0; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| vg0104923119 | G -> A | LOC_Os01g09590-LOC_Os01g09600 | intergenic_region ; MODIFIER | silent_mutation | Average:66.0; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| vg0104923119 | G -> GA | LOC_Os01g09590.1 | upstream_gene_variant ; 3896.0bp to feature; MODIFIER | silent_mutation | Average:66.0; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| vg0104923119 | G -> GA | LOC_Os01g09590-LOC_Os01g09600 | intergenic_region ; MODIFIER | silent_mutation | Average:66.0; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0104923119 | 2.09E-06 | NA | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104923119 | NA | 1.07E-07 | mr1312 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104923119 | NA | 2.63E-07 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104923119 | NA | 5.98E-08 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104923119 | 2.17E-07 | NA | mr1495 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104923119 | NA | 7.34E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104923119 | NA | 8.47E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |