Search for Variation information by Variation ID:
Detailed information for vg0104860223:
| Variant ID: vg0104860223 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 4860223 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 113. )
Flanking Sequence (100 bp) in Reference Genome:
GCGCAACCAAGAAACTTTACTTTCAGATCTAGCGGAAACTTTTGAAAACCTCCGCTCCGCCCGCATAAAACTGAACCCCGATAAGTGCGTGTTTGGTGTA[C/G]
CCGCGGGCAAGCTTCTCGGGTTTTTGGTCTCTGCCCGAGGCATTGAGGCCAACCCCGAGAAGATACGAGCTATAGAACGGATGCGCCCCCCCAGCAAACT
Reverse complement sequence
AGTTTGCTGGGGGGGCGCATCCGTTCTATAGCTCGTATCTTCTCGGGGTTGGCCTCAATGCCTCGGGCAGAGACCAAAAACCCGAGAAGCTTGCCCGCGG[G/C]
TACACCAAACACGCACTTATCGGGGTTCAGTTTTATGCGGGCGGAGCGGAGGTTTTCAAAAGTTTCCGCTAGATCTGAAAGTAAAGTTTCTTGGTTGCGC
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.80% | 6.10% | 13.16% | 11.96% | NA |
| All Indica | 2759 | 54.20% | 9.70% | 19.64% | 16.42% | NA |
| All Japonica | 1512 | 92.30% | 1.10% | 0.79% | 5.82% | NA |
| Aus | 269 | 69.50% | 0.00% | 22.30% | 8.18% | NA |
| Indica I | 595 | 49.70% | 0.30% | 24.37% | 25.55% | NA |
| Indica II | 465 | 25.60% | 40.00% | 25.81% | 8.60% | NA |
| Indica III | 913 | 72.10% | 0.10% | 12.49% | 15.33% | NA |
| Indica Intermediate | 786 | 53.80% | 10.10% | 20.74% | 15.39% | NA |
| Temperate Japonica | 767 | 95.70% | 0.10% | 0.65% | 3.52% | NA |
| Tropical Japonica | 504 | 84.30% | 2.60% | 1.39% | 11.71% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 3.30% | 8.89% | 2.22% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0104860223 | C -> G | LOC_Os01g09520.1 | missense_variant ; p.Pro1007Ala; MODERATE | nonsynonymous_codon ; P1007A | Average:18.721; most accessible tissue: Minghui63 young leaf, score: 47.146 | benign  |
1.338 |
DELETERIOUS | 0.00 |
| vg0104860223 | C -> DEL | LOC_Os01g09520.1 | N | frameshift_variant | Average:18.721; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0104860223 | NA | 1.54E-06 | mr1158 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104860223 | NA | 5.80E-06 | mr1168 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104860223 | NA | 8.39E-06 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104860223 | 9.55E-06 | NA | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104860223 | 6.69E-06 | 4.26E-08 | mr1383 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104860223 | NA | 1.33E-10 | mr1158_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104860223 | NA | 5.19E-12 | mr1158_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104860223 | 6.84E-07 | NA | mr1168_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104860223 | 7.75E-08 | 1.70E-07 | mr1168_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104860223 | 2.76E-06 | 5.03E-13 | mr1383_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |