Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104815238:

Variant ID: vg0104815238 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4815238
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.10, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTCTCATCGGCTACTTGCTTTACTTTTTTTTTTTTTTGGCCTTTTAACAGTTTTGACATGTGCTGTTGCAGTGTTGGTAGTACCTGCCTATCTGGAAG[G/A]
AATGTGCGTTAATTCTACAAGAGGGGGGACCAATCGTTTTTGCCAATATTCTGTGCAATCAACAAACTGACGACACTGACTGTGATTAAAAGAGCTTAAC

Reverse complement sequence

GTTAAGCTCTTTTAATCACAGTCAGTGTCGTCAGTTTGTTGATTGCACAGAATATTGGCAAAAACGATTGGTCCCCCCTCTTGTAGAATTAACGCACATT[C/T]
CTTCCAGATAGGCAGGTACTACCAACACTGCAACAGCACATGTCAAAACTGTTAAAAGGCCAAAAAAAAAAAAAAGTAAAGCAAGTAGCCGATGAGAAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 32.10% 0.04% 0.00% NA
All Indica  2759 98.40% 1.50% 0.04% 0.00% NA
All Japonica  1512 7.20% 92.80% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 99.30% 0.50% 0.17% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 5.50% 94.50% 0.00% 0.00% NA
Tropical Japonica  504 8.90% 91.10% 0.00% 0.00% NA
Japonica Intermediate  241 9.10% 90.90% 0.00% 0.00% NA
VI/Aromatic  96 62.50% 37.50% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104815238 G -> A LOC_Os01g09450.1 upstream_gene_variant ; 1607.0bp to feature; MODIFIER silent_mutation Average:81.779; most accessible tissue: Minghui63 flower, score: 91.834 N N N N
vg0104815238 G -> A LOC_Os01g09450.2 upstream_gene_variant ; 1607.0bp to feature; MODIFIER silent_mutation Average:81.779; most accessible tissue: Minghui63 flower, score: 91.834 N N N N
vg0104815238 G -> A LOC_Os01g09460.1 downstream_gene_variant ; 4866.0bp to feature; MODIFIER silent_mutation Average:81.779; most accessible tissue: Minghui63 flower, score: 91.834 N N N N
vg0104815238 G -> A LOC_Os01g09440-LOC_Os01g09450 intergenic_region ; MODIFIER silent_mutation Average:81.779; most accessible tissue: Minghui63 flower, score: 91.834 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0104815238 G A -0.06 -0.04 -0.03 -0.09 -0.11 -0.18

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104815238 NA 1.71E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104815238 1.35E-06 1.35E-06 mr1200 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104815238 NA 4.45E-20 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104815238 NA 3.68E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104815238 NA 2.23E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104815238 NA 2.76E-23 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104815238 NA 6.14E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104815238 NA 1.26E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104815238 NA 2.53E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104815238 2.60E-06 6.18E-06 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104815238 NA 2.35E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104815238 NA 4.88E-23 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251