\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104785744:

Variant ID: vg0104785744 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4785744
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCAAATAAATCCAAATGAAAGTCGAACGCGAAAGTCGATTCTTTTATATTAACTTTACTATTCGCGAACTAGGGCAAACTCCACTTCAATTTAAACTAT[G/T]
TTGCGAGAAGAATTATTTTGTTGTCATGAGTTTTTAATTTAACCTACCCGAGCAACATATCATTTAATAGGTTAGAAATTTCTATCGCGAGCTAAATGTC

Reverse complement sequence

GACATTTAGCTCGCGATAGAAATTTCTAACCTATTAAATGATATGTTGCTCGGGTAGGTTAAATTAAAAACTCATGACAACAAAATAATTCTTCTCGCAA[C/A]
ATAGTTTAAATTGAAGTGGAGTTTGCCCTAGTTCGCGAATAGTAAAGTTAATATAAAAGAATCGACTTTCGCGTTCGACTTTCATTTGGATTTATTTGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.80% 0.70% 12.40% 48.18% NA
All Indica  2759 8.90% 1.00% 13.12% 76.95% NA
All Japonica  1512 96.00% 0.10% 1.12% 2.78% NA
Aus  269 17.80% 0.70% 59.11% 22.30% NA
Indica I  595 7.60% 0.00% 4.37% 88.07% NA
Indica II  465 10.30% 0.00% 11.61% 78.06% NA
Indica III  913 5.60% 2.60% 18.40% 73.38% NA
Indica Intermediate  786 13.00% 0.50% 14.50% 72.01% NA
Temperate Japonica  767 99.00% 0.00% 0.13% 0.91% NA
Tropical Japonica  504 93.80% 0.20% 2.38% 3.57% NA
Japonica Intermediate  241 91.30% 0.00% 1.66% 7.05% NA
VI/Aromatic  96 43.80% 0.00% 37.50% 18.75% NA
Intermediate  90 48.90% 0.00% 13.33% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104785744 G -> T LOC_Os01g09384.1 upstream_gene_variant ; 3038.0bp to feature; MODIFIER silent_mutation Average:8.63; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 N N N N
vg0104785744 G -> T LOC_Os01g09400.1 upstream_gene_variant ; 734.0bp to feature; MODIFIER silent_mutation Average:8.63; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 N N N N
vg0104785744 G -> T LOC_Os01g09384-LOC_Os01g09400 intergenic_region ; MODIFIER silent_mutation Average:8.63; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 N N N N
vg0104785744 G -> DEL N N silent_mutation Average:8.63; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104785744 NA 1.63E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744 NA 1.31E-07 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744 6.46E-08 6.46E-08 mr1249 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744 NA 7.84E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744 NA 7.84E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744 NA 7.65E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744 NA 1.29E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744 NA 1.12E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744 NA 4.15E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744 NA 9.63E-08 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744 NA 3.03E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744 9.10E-06 9.10E-06 mr1151_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251