Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104785744:

Variant ID: vg0104785744 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 4785744
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCAAATAAATCCAAATGAAAGTCGAACGCGAAAGTCGATTCTTTTATATTAACTTTACTATTCGCGAACTAGGGCAAACTCCACTTCAATTTAAACTAT[G/T]
TTGCGAGAAGAATTATTTTGTTGTCATGAGTTTTTAATTTAACCTACCCGAGCAACATATCATTTAATAGGTTAGAAATTTCTATCGCGAGCTAAATGTC

Reverse complement sequence

GACATTTAGCTCGCGATAGAAATTTCTAACCTATTAAATGATATGTTGCTCGGGTAGGTTAAATTAAAAACTCATGACAACAAAATAATTCTTCTCGCAA[C/A]
ATAGTTTAAATTGAAGTGGAGTTTGCCCTAGTTCGCGAATAGTAAAGTTAATATAAAAGAATCGACTTTCGCGTTCGACTTTCATTTGGATTTATTTGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.80%	0.70%	12.40%	48.18%	NA
All Indica	2759	8.90%	1.00%	13.12%	76.95%	NA
All Japonica	1512	96.00%	0.10%	1.12%	2.78%	NA
Aus	269	17.80%	0.70%	59.11%	22.30%	NA
Indica I	595	7.60%	0.00%	4.37%	88.07%	NA
Indica II	465	10.30%	0.00%	11.61%	78.06%	NA
Indica III	913	5.60%	2.60%	18.40%	73.38%	NA
Indica Intermediate	786	13.00%	0.50%	14.50%	72.01%	NA
Temperate Japonica	767	99.00%	0.00%	0.13%	0.91%	NA
Tropical Japonica	504	93.80%	0.20%	2.38%	3.57%	NA
Japonica Intermediate	241	91.30%	0.00%	1.66%	7.05%	NA
VI/Aromatic	96	43.80%	0.00%	37.50%	18.75%	NA
Intermediate	90	48.90%	0.00%	13.33%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0104785744	G -> T	LOC_Os01g09384.1	upstream_gene_variant ; 3038.0bp to feature; MODIFIER	silent_mutation	Average:8.63; most accessible tissue: Zhenshan97 flag leaf, score: 12.605	N	N	N	N
vg0104785744	G -> T	LOC_Os01g09400.1	upstream_gene_variant ; 734.0bp to feature; MODIFIER	silent_mutation	Average:8.63; most accessible tissue: Zhenshan97 flag leaf, score: 12.605	N	N	N	N
vg0104785744	G -> T	LOC_Os01g09384-LOC_Os01g09400	intergenic_region ; MODIFIER	silent_mutation	Average:8.63; most accessible tissue: Zhenshan97 flag leaf, score: 12.605	N	N	N	N
vg0104785744	G -> DEL	N	N	silent_mutation	Average:8.63; most accessible tissue: Zhenshan97 flag leaf, score: 12.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0104785744	NA	1.63E-09	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744	NA	1.31E-07	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744	6.46E-08	6.46E-08	mr1249	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744	NA	7.84E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744	NA	7.84E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744	NA	7.65E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744	NA	1.29E-08	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744	NA	1.12E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744	NA	4.15E-20	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744	NA	9.63E-08	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744	NA	3.03E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104785744	9.10E-06	9.10E-06	mr1151_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251