\
| Variant ID: vg0104785744 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 4785744 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCAAATAAATCCAAATGAAAGTCGAACGCGAAAGTCGATTCTTTTATATTAACTTTACTATTCGCGAACTAGGGCAAACTCCACTTCAATTTAAACTAT[G/T]
TTGCGAGAAGAATTATTTTGTTGTCATGAGTTTTTAATTTAACCTACCCGAGCAACATATCATTTAATAGGTTAGAAATTTCTATCGCGAGCTAAATGTC
GACATTTAGCTCGCGATAGAAATTTCTAACCTATTAAATGATATGTTGCTCGGGTAGGTTAAATTAAAAACTCATGACAACAAAATAATTCTTCTCGCAA[C/A]
ATAGTTTAAATTGAAGTGGAGTTTGCCCTAGTTCGCGAATAGTAAAGTTAATATAAAAGAATCGACTTTCGCGTTCGACTTTCATTTGGATTTATTTGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.80% | 0.70% | 12.40% | 48.18% | NA |
| All Indica | 2759 | 8.90% | 1.00% | 13.12% | 76.95% | NA |
| All Japonica | 1512 | 96.00% | 0.10% | 1.12% | 2.78% | NA |
| Aus | 269 | 17.80% | 0.70% | 59.11% | 22.30% | NA |
| Indica I | 595 | 7.60% | 0.00% | 4.37% | 88.07% | NA |
| Indica II | 465 | 10.30% | 0.00% | 11.61% | 78.06% | NA |
| Indica III | 913 | 5.60% | 2.60% | 18.40% | 73.38% | NA |
| Indica Intermediate | 786 | 13.00% | 0.50% | 14.50% | 72.01% | NA |
| Temperate Japonica | 767 | 99.00% | 0.00% | 0.13% | 0.91% | NA |
| Tropical Japonica | 504 | 93.80% | 0.20% | 2.38% | 3.57% | NA |
| Japonica Intermediate | 241 | 91.30% | 0.00% | 1.66% | 7.05% | NA |
| VI/Aromatic | 96 | 43.80% | 0.00% | 37.50% | 18.75% | NA |
| Intermediate | 90 | 48.90% | 0.00% | 13.33% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0104785744 | G -> T | LOC_Os01g09384.1 | upstream_gene_variant ; 3038.0bp to feature; MODIFIER | silent_mutation | Average:8.63; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 | N | N | N | N |
| vg0104785744 | G -> T | LOC_Os01g09400.1 | upstream_gene_variant ; 734.0bp to feature; MODIFIER | silent_mutation | Average:8.63; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 | N | N | N | N |
| vg0104785744 | G -> T | LOC_Os01g09384-LOC_Os01g09400 | intergenic_region ; MODIFIER | silent_mutation | Average:8.63; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 | N | N | N | N |
| vg0104785744 | G -> DEL | N | N | silent_mutation | Average:8.63; most accessible tissue: Zhenshan97 flag leaf, score: 12.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0104785744 | NA | 1.63E-09 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104785744 | NA | 1.31E-07 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104785744 | 6.46E-08 | 6.46E-08 | mr1249 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104785744 | NA | 7.84E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104785744 | NA | 7.84E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104785744 | NA | 7.65E-12 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104785744 | NA | 1.29E-08 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104785744 | NA | 1.12E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104785744 | NA | 4.15E-20 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104785744 | NA | 9.63E-08 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104785744 | NA | 3.03E-13 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104785744 | 9.10E-06 | 9.10E-06 | mr1151_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |