\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104593340:

Variant ID: vg0104593340 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4593340
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGCCACCTCTCTCTCTAACTCTTTTTCTCTTTTCTTTTCGCGAGACAACACAGCTCCAGACTTAAACTAATTTTGCTCCTCACAACTTTCCACATTGG[C/A]
CATCGATAGCGTATATATACATGGACTCATGGAGTACAACTGTATAATGTATACCGAAAAAAACTTTTCTTTTTGTGTGTGCCGCTGGTGGTGGTCGGCT

Reverse complement sequence

AGCCGACCACCACCAGCGGCACACACAAAAAGAAAAGTTTTTTTCGGTATACATTATACAGTTGTACTCCATGAGTCCATGTATATATACGCTATCGATG[G/T]
CCAATGTGGAAAGTTGTGAGGAGCAAAATTAGTTTAAGTCTGGAGCTGTGTTGTCTCGCGAAAAGAAAAGAGAAAAAGAGTTAGAGAGAGAGGTGGCCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.50% 19.90% 0.89% 15.72% NA
All Indica  2759 82.00% 1.10% 0.76% 16.17% NA
All Japonica  1512 42.50% 56.00% 0.73% 0.86% NA
Aus  269 9.70% 0.70% 3.35% 86.25% NA
Indica I  595 69.40% 0.20% 1.18% 29.24% NA
Indica II  465 94.20% 3.00% 0.00% 2.80% NA
Indica III  913 80.80% 0.80% 0.55% 17.85% NA
Indica Intermediate  786 85.80% 0.90% 1.15% 12.21% NA
Temperate Japonica  767 37.70% 60.80% 0.39% 1.17% NA
Tropical Japonica  504 60.90% 37.50% 0.79% 0.79% NA
Japonica Intermediate  241 19.10% 79.30% 1.66% 0.00% NA
VI/Aromatic  96 9.40% 50.00% 0.00% 40.62% NA
Intermediate  90 65.60% 18.90% 1.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104593340 C -> A LOC_Os01g09150.1 upstream_gene_variant ; 2720.0bp to feature; MODIFIER silent_mutation Average:67.378; most accessible tissue: Zhenshan97 root, score: 95.656 N N N N
vg0104593340 C -> A LOC_Os01g09140.1 downstream_gene_variant ; 1968.0bp to feature; MODIFIER silent_mutation Average:67.378; most accessible tissue: Zhenshan97 root, score: 95.656 N N N N
vg0104593340 C -> A LOC_Os01g09140-LOC_Os01g09150 intergenic_region ; MODIFIER silent_mutation Average:67.378; most accessible tissue: Zhenshan97 root, score: 95.656 N N N N
vg0104593340 C -> DEL N N silent_mutation Average:67.378; most accessible tissue: Zhenshan97 root, score: 95.656 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0104593340 C A -0.02 0.06 0.04 0.0 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104593340 NA 4.07E-06 mr1555 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 3.60E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 1.71E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 1.24E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 7.07E-06 mr1555_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 5.93E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 2.84E-06 1.12E-23 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 7.16E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 1.26E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 2.45E-06 2.05E-14 mr1720_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 6.88E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 6.48E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 3.71E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 1.28E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 7.54E-08 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 4.59E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 2.60E-10 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 2.80E-17 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104593340 NA 2.89E-17 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251