Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104580865:

Variant ID: vg0104580865 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 4580865
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGATGCAGCACATTGTGGCTAAGGCTATGTTTAGTTCAGCATAAAGTTTAGATTTTGATTAAAATTGAAGATGATGTGACTGAAAAGAAAAGTTGTGTGT[G/A]
TATGACAGGTTGATGTGATGGAAAATGACTGAAGTTTGGATCCAAACTTTGGATCTAAACACAGCCTAAGGAGTAGAACTTGGATTAAATAATACAAAAG

Reverse complement sequence

CTTTTGTATTATTTAATCCAAGTTCTACTCCTTAGGCTGTGTTTAGATCCAAAGTTTGGATCCAAACTTCAGTCATTTTCCATCACATCAACCTGTCATA[C/T]
ACACACAACTTTTCTTTTCAGTCACATCATCTTCAATTTTAATCAAAATCTAAACTTTATGCTGAACTAAACATAGCCTTAGCCACAATGTGCTGCATCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.30%	0.90%	3.20%	46.68%	NA
All Indica	2759	24.60%	0.00%	0.98%	74.45%	NA
All Japonica	1512	82.70%	2.60%	7.94%	6.68%	NA
Aus	269	93.70%	0.00%	0.00%	6.32%	NA
Indica I	595	42.00%	0.00%	1.01%	56.97%	NA
Indica II	465	11.20%	0.00%	0.22%	88.60%	NA
Indica III	913	24.40%	0.00%	0.99%	74.59%	NA
Indica Intermediate	786	19.50%	0.00%	1.40%	79.13%	NA
Temperate Japonica	767	94.50%	0.50%	3.91%	1.04%	NA
Tropical Japonica	504	61.30%	6.50%	16.27%	15.87%	NA
Japonica Intermediate	241	90.00%	1.20%	3.32%	5.39%	NA
VI/Aromatic	96	95.80%	0.00%	1.04%	3.12%	NA
Intermediate	90	61.10%	1.10%	3.33%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0104580865	G -> A	LOC_Os01g09110.1	downstream_gene_variant ; 4710.0bp to feature; MODIFIER	silent_mutation	Average:84.894; most accessible tissue: Zhenshan97 young leaf, score: 98.448	N	N	N	N
vg0104580865	G -> A	LOC_Os01g09120.1	downstream_gene_variant ; 283.0bp to feature; MODIFIER	silent_mutation	Average:84.894; most accessible tissue: Zhenshan97 young leaf, score: 98.448	N	N	N	N
vg0104580865	G -> A	LOC_Os01g09120.2	downstream_gene_variant ; 283.0bp to feature; MODIFIER	silent_mutation	Average:84.894; most accessible tissue: Zhenshan97 young leaf, score: 98.448	N	N	N	N
vg0104580865	G -> A	LOC_Os01g09110-LOC_Os01g09120	intergenic_region ; MODIFIER	silent_mutation	Average:84.894; most accessible tissue: Zhenshan97 young leaf, score: 98.448	N	N	N	N
vg0104580865	G -> DEL	N	N	silent_mutation	Average:84.894; most accessible tissue: Zhenshan97 young leaf, score: 98.448	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0104580865	G	A	-0.01	0.0	0.01	0.0	0.0	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0104580865	1.35E-06	NA	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104580865	NA	4.78E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104580865	NA	1.19E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104580865	NA	4.28E-06	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104580865	NA	7.59E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104580865	NA	7.56E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104580865	NA	7.05E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104580865	NA	5.16E-06	mr1320_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104580865	9.39E-07	9.39E-07	mr1320_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104580865	NA	1.77E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104580865	NA	9.39E-07	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104580865	NA	1.76E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104580865	NA	9.48E-06	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251