Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104578620:

Variant ID: vg0104578620 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4578620
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAAGTGCAGTTATGATTTTCCGTGTCCAACGTTTGACTGTACGTCTTATTTAAAAATTATATGAAAAAATAATAAAAAAAAGATAGTCTCACCATAAAG[T/C]
ATTATTAATGTTTTATCATCTAGTAATAAATAAAAATACTAATCATAACAATTTTTTTAAGTTAGACAGACAGTCAAATGTTGAATATAAACAACGCAAA

Reverse complement sequence

TTTGCGTTGTTTATATTCAACATTTGACTGTCTGTCTAACTTAAAAAAATTGTTATGATTAGTATTTTTATTTATTACTAGATGATAAAACATTAATAAT[A/G]
CTTTATGGTGAGACTATCTTTTTTTTATTATTTTTTCATATAATTTTTAAATAAGACGTACAGTCAAACGTTGGACACGGAAAATCATAACTGCACTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.40% 28.60% 0.04% 0.00% NA
All Indica  2759 99.10% 0.90% 0.00% 0.00% NA
All Japonica  1512 16.80% 83.20% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 7.20% 92.80% 0.00% 0.00% NA
Tropical Japonica  504 34.30% 65.70% 0.00% 0.00% NA
Japonica Intermediate  241 10.80% 89.20% 0.00% 0.00% NA
VI/Aromatic  96 57.30% 41.70% 1.04% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104578620 T -> C LOC_Os01g09110.1 downstream_gene_variant ; 2465.0bp to feature; MODIFIER silent_mutation Average:79.987; most accessible tissue: Minghui63 root, score: 92.025 N N N N
vg0104578620 T -> C LOC_Os01g09120.1 downstream_gene_variant ; 2528.0bp to feature; MODIFIER silent_mutation Average:79.987; most accessible tissue: Minghui63 root, score: 92.025 N N N N
vg0104578620 T -> C LOC_Os01g09120.2 downstream_gene_variant ; 2528.0bp to feature; MODIFIER silent_mutation Average:79.987; most accessible tissue: Minghui63 root, score: 92.025 N N N N
vg0104578620 T -> C LOC_Os01g09110-LOC_Os01g09120 intergenic_region ; MODIFIER silent_mutation Average:79.987; most accessible tissue: Minghui63 root, score: 92.025 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0104578620 T C -0.01 -0.02 -0.01 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104578620 NA 1.10E-06 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 4.71E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 2.36E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 9.25E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 3.04E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 1.89E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 1.62E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 1.31E-15 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 7.08E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 9.12E-06 mr1239_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 7.83E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 6.31E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 5.33E-06 5.33E-06 mr1320_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 5.72E-24 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 5.83E-13 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 3.03E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 3.33E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 3.18E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 1.05E-39 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 4.99E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 1.77E-43 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 1.93E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104578620 NA 4.55E-08 mr1804_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251