\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104574233:

Variant ID: vg0104574233 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4574233
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGAGGTGACCAAGGGAGAATCTTTTACCTCAATCTTAATTTTTGCTAAACAATCTCAGAGTTTGTTTGGGAGGTTTCGGACAGCTCAATTTTCTCTCA[G/T]
AATTAAAATTTCTGCCAAACAATTCAGCATTTTGTCCATATTATAACCAGCTATATCAGCATAATTCAGAAAATAAAGTAGAAGCAAGAAATTGGTAACT

Reverse complement sequence

AGTTACCAATTTCTTGCTTCTACTTTATTTTCTGAATTATGCTGATATAGCTGGTTATAATATGGACAAAATGCTGAATTGTTTGGCAGAAATTTTAATT[C/A]
TGAGAGAAAATTGAGCTGTCCGAAACCTCCCAAACAAACTCTGAGATTGTTTAGCAAAAATTAAGATTGAGGTAAAAGATTCTCCCTTGGTCACCTCCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 10.10% 0.06% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 69.60% 30.40% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 95.70% 4.20% 0.13% 0.00% NA
Tropical Japonica  504 38.50% 61.50% 0.00% 0.00% NA
Japonica Intermediate  241 51.50% 48.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104574233 G -> T LOC_Os01g09100.1 upstream_gene_variant ; 824.0bp to feature; MODIFIER silent_mutation Average:59.108; most accessible tissue: Minghui63 root, score: 79.068 N N N N
vg0104574233 G -> T LOC_Os01g09110.1 upstream_gene_variant ; 1479.0bp to feature; MODIFIER silent_mutation Average:59.108; most accessible tissue: Minghui63 root, score: 79.068 N N N N
vg0104574233 G -> T LOC_Os01g09090.1 downstream_gene_variant ; 2015.0bp to feature; MODIFIER silent_mutation Average:59.108; most accessible tissue: Minghui63 root, score: 79.068 N N N N
vg0104574233 G -> T LOC_Os01g09100-LOC_Os01g09110 intergenic_region ; MODIFIER silent_mutation Average:59.108; most accessible tissue: Minghui63 root, score: 79.068 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104574233 4.63E-07 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233 NA 9.67E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233 NA 5.22E-08 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233 3.19E-07 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233 7.48E-06 NA mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233 9.02E-06 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233 2.54E-06 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233 8.01E-10 NA mr1489 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233 2.65E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233 2.18E-09 NA mr1778 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233 NA 2.37E-12 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233 NA 3.22E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251