\
| Variant ID: vg0104574233 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 4574233 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )
AAGGAGGTGACCAAGGGAGAATCTTTTACCTCAATCTTAATTTTTGCTAAACAATCTCAGAGTTTGTTTGGGAGGTTTCGGACAGCTCAATTTTCTCTCA[G/T]
AATTAAAATTTCTGCCAAACAATTCAGCATTTTGTCCATATTATAACCAGCTATATCAGCATAATTCAGAAAATAAAGTAGAAGCAAGAAATTGGTAACT
AGTTACCAATTTCTTGCTTCTACTTTATTTTCTGAATTATGCTGATATAGCTGGTTATAATATGGACAAAATGCTGAATTGTTTGGCAGAAATTTTAATT[C/A]
TGAGAGAAAATTGAGCTGTCCGAAACCTCCCAAACAAACTCTGAGATTGTTTAGCAAAAATTAAGATTGAGGTAAAAGATTCTCCCTTGGTCACCTCCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 10.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 69.60% | 30.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.70% | 4.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 38.50% | 61.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.50% | 48.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 11.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0104574233 | G -> T | LOC_Os01g09100.1 | upstream_gene_variant ; 824.0bp to feature; MODIFIER | silent_mutation | Average:59.108; most accessible tissue: Minghui63 root, score: 79.068 | N | N | N | N |
| vg0104574233 | G -> T | LOC_Os01g09110.1 | upstream_gene_variant ; 1479.0bp to feature; MODIFIER | silent_mutation | Average:59.108; most accessible tissue: Minghui63 root, score: 79.068 | N | N | N | N |
| vg0104574233 | G -> T | LOC_Os01g09090.1 | downstream_gene_variant ; 2015.0bp to feature; MODIFIER | silent_mutation | Average:59.108; most accessible tissue: Minghui63 root, score: 79.068 | N | N | N | N |
| vg0104574233 | G -> T | LOC_Os01g09100-LOC_Os01g09110 | intergenic_region ; MODIFIER | silent_mutation | Average:59.108; most accessible tissue: Minghui63 root, score: 79.068 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0104574233 | 4.63E-07 | NA | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104574233 | NA | 9.67E-10 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104574233 | NA | 5.22E-08 | mr1022 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104574233 | 3.19E-07 | NA | mr1023 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104574233 | 7.48E-06 | NA | mr1079 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104574233 | 9.02E-06 | NA | mr1132 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104574233 | 2.54E-06 | NA | mr1142 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104574233 | 8.01E-10 | NA | mr1489 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104574233 | 2.65E-06 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104574233 | 2.18E-09 | NA | mr1778 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104574233 | NA | 2.37E-12 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104574233 | NA | 3.22E-13 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |