Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104574233:

Variant ID: vg0104574233 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 4574233
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

AAGGAGGTGACCAAGGGAGAATCTTTTACCTCAATCTTAATTTTTGCTAAACAATCTCAGAGTTTGTTTGGGAGGTTTCGGACAGCTCAATTTTCTCTCA[G/T]
AATTAAAATTTCTGCCAAACAATTCAGCATTTTGTCCATATTATAACCAGCTATATCAGCATAATTCAGAAAATAAAGTAGAAGCAAGAAATTGGTAACT

Reverse complement sequence

AGTTACCAATTTCTTGCTTCTACTTTATTTTCTGAATTATGCTGATATAGCTGGTTATAATATGGACAAAATGCTGAATTGTTTGGCAGAAATTTTAATT[C/A]
TGAGAGAAAATTGAGCTGTCCGAAACCTCCCAAACAAACTCTGAGATTGTTTAGCAAAAATTAAGATTGAGGTAAAAGATTCTCCCTTGGTCACCTCCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.80%	10.10%	0.06%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	69.60%	30.40%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	95.70%	4.20%	0.13%	0.00%	NA
Tropical Japonica	504	38.50%	61.50%	0.00%	0.00%	NA
Japonica Intermediate	241	51.50%	48.50%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0104574233	G -> T	LOC_Os01g09100.1	upstream_gene_variant ; 824.0bp to feature; MODIFIER	silent_mutation	Average:59.108; most accessible tissue: Minghui63 root, score: 79.068	N	N	N	N
vg0104574233	G -> T	LOC_Os01g09110.1	upstream_gene_variant ; 1479.0bp to feature; MODIFIER	silent_mutation	Average:59.108; most accessible tissue: Minghui63 root, score: 79.068	N	N	N	N
vg0104574233	G -> T	LOC_Os01g09090.1	downstream_gene_variant ; 2015.0bp to feature; MODIFIER	silent_mutation	Average:59.108; most accessible tissue: Minghui63 root, score: 79.068	N	N	N	N
vg0104574233	G -> T	LOC_Os01g09100-LOC_Os01g09110	intergenic_region ; MODIFIER	silent_mutation	Average:59.108; most accessible tissue: Minghui63 root, score: 79.068	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0104574233	4.63E-07	NA	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233	NA	9.67E-10	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233	NA	5.22E-08	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233	3.19E-07	NA	mr1023	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233	7.48E-06	NA	mr1079	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233	9.02E-06	NA	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233	2.54E-06	NA	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233	8.01E-10	NA	mr1489	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233	2.65E-06	NA	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233	2.18E-09	NA	mr1778	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233	NA	2.37E-12	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104574233	NA	3.22E-13	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251