\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104557963:

Variant ID: vg0104557963 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4557963
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CGACCTTGGCGGTCAAGCGCTCGGCTGGCGGCAGCGGCGGTTTCGTGGGCGATGCGAAAGCGGCGACGGCGTGGATGCTTTGGGCGGCGAAGGCGGTGGA[T/C]
CGGACGGCCGAATCCGAACCACGGGAGCGCAGGCTGGCGCGGTCAAGGTGGGGGCGGCGAGCTGGCGTGCGGCGTCAGCGGTGCTCTGCCTCAGCGCGCA

Reverse complement sequence

TGCGCGCTGAGGCAGAGCACCGCTGACGCCGCACGCCAGCTCGCCGCCCCCACCTTGACCGCGCCAGCCTGCGCTCCCGTGGTTCGGATTCGGCCGTCCG[A/G]
TCCACCGCCTTCGCCGCCCAAAGCATCCACGCCGTCGCCGCTTTCGCATCGCCCACGAAACCGCCGCTGCCGCCAGCCGAGCGCTTGACCGCCAAGGTCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 3.40% 7.55% 18.49% NA
All Indica  2759 77.30% 1.30% 7.10% 14.28% NA
All Japonica  1512 54.00% 7.70% 8.27% 30.09% NA
Aus  269 87.40% 1.90% 10.78% 0.00% NA
Indica I  595 75.80% 2.40% 11.43% 10.42% NA
Indica II  465 51.00% 1.90% 13.12% 33.98% NA
Indica III  913 93.20% 0.20% 1.53% 5.04% NA
Indica Intermediate  786 75.70% 1.30% 6.74% 16.28% NA
Temperate Japonica  767 54.20% 1.20% 5.74% 38.85% NA
Tropical Japonica  504 52.80% 19.20% 11.31% 16.67% NA
Japonica Intermediate  241 55.60% 4.10% 9.96% 30.29% NA
VI/Aromatic  96 88.50% 2.10% 3.12% 6.25% NA
Intermediate  90 71.10% 3.30% 4.44% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104557963 T -> DEL N N silent_mutation Average:73.246; most accessible tissue: Zhenshan97 flower, score: 99.227 N N N N
vg0104557963 T -> C LOC_Os01g09050.1 upstream_gene_variant ; 3323.0bp to feature; MODIFIER silent_mutation Average:73.246; most accessible tissue: Zhenshan97 flower, score: 99.227 N N N N
vg0104557963 T -> C LOC_Os01g09060.1 downstream_gene_variant ; 1043.0bp to feature; MODIFIER silent_mutation Average:73.246; most accessible tissue: Zhenshan97 flower, score: 99.227 N N N N
vg0104557963 T -> C LOC_Os01g09050-LOC_Os01g09060 intergenic_region ; MODIFIER silent_mutation Average:73.246; most accessible tissue: Zhenshan97 flower, score: 99.227 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0104557963 T C 0.01 0.02 0.03 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104557963 NA 7.65E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 1.06E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 3.44E-08 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 7.68E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 2.64E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 7.17E-07 8.05E-09 mr1239_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 1.77E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 4.08E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 4.41E-07 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 3.81E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 6.68E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 7.09E-06 7.09E-06 mr1372_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 7.79E-06 mr1403_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 3.10E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 4.00E-06 NA mr1506_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 6.04E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 2.30E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 9.59E-06 mr1638_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 1.03E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 6.19E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 5.10E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 5.96E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 3.23E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 3.50E-09 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104557963 NA 3.76E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251