\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104428821:

Variant ID: vg0104428821 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4428821
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTGAATTTAAATTCAAATATTTTTTTATATATAGTATTTAGATACATCTAAAGTTTATACACCTAAAGTTTATAGACCCAAAGTTTATAAGTCAAAA[T/G]
TTTACATACCCAATTCAAATTTGAATTTGAATTTGTATCCGATTCAAATTTGAATTTGAATTATATCCGATTCAAATTTGAATTTGAATTCAAATATTTT

Reverse complement sequence

AAAATATTTGAATTCAAATTCAAATTTGAATCGGATATAATTCAAATTCAAATTTGAATCGGATACAAATTCAAATTCAAATTTGAATTGGGTATGTAAA[A/C]
TTTTGACTTATAAACTTTGGGTCTATAAACTTTAGGTGTATAAACTTTAGATGTATCTAAATACTATATATAAAAAAATATTTGAATTTAAATTCAAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 18.60% 17.48% 4.72% NA
All Indica  2759 70.30% 0.50% 21.75% 7.47% NA
All Japonica  1512 39.90% 55.20% 4.30% 0.53% NA
Aus  269 45.00% 0.00% 53.16% 1.86% NA
Indica I  595 64.20% 0.00% 26.55% 9.24% NA
Indica II  465 68.80% 1.50% 18.06% 11.61% NA
Indica III  913 80.60% 0.00% 16.54% 2.85% NA
Indica Intermediate  786 63.90% 0.80% 26.34% 9.03% NA
Temperate Japonica  767 7.40% 90.60% 1.43% 0.52% NA
Tropical Japonica  504 88.10% 3.20% 8.13% 0.60% NA
Japonica Intermediate  241 42.70% 51.50% 5.39% 0.41% NA
VI/Aromatic  96 78.10% 17.70% 4.17% 0.00% NA
Intermediate  90 65.60% 14.40% 15.56% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104428821 T -> G LOC_Os01g08814.1 upstream_gene_variant ; 1937.0bp to feature; MODIFIER silent_mutation Average:19.556; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0104428821 T -> G LOC_Os01g08814.2 upstream_gene_variant ; 1937.0bp to feature; MODIFIER silent_mutation Average:19.556; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0104428821 T -> G LOC_Os01g08814.3 upstream_gene_variant ; 1937.0bp to feature; MODIFIER silent_mutation Average:19.556; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0104428821 T -> G LOC_Os01g08820.1 downstream_gene_variant ; 2711.0bp to feature; MODIFIER silent_mutation Average:19.556; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0104428821 T -> G LOC_Os01g08814-LOC_Os01g08820 intergenic_region ; MODIFIER silent_mutation Average:19.556; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0104428821 T -> DEL N N silent_mutation Average:19.556; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104428821 NA 2.28E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0104428821 NA 3.25E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 4.97E-19 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 8.06E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 1.82E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 1.04E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 8.88E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 4.38E-15 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 2.01E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 1.15E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 3.31E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 5.68E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 1.60E-10 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 2.48E-21 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 6.66E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 1.27E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 3.46E-07 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 2.02E-17 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 9.46E-07 NA mr1852 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 6.66E-06 NA mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 3.65E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 6.09E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 1.09E-06 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 2.12E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821 NA 1.53E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251