Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104428821:

Variant ID: vg0104428821 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 4428821
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTGAATTTAAATTCAAATATTTTTTTATATATAGTATTTAGATACATCTAAAGTTTATACACCTAAAGTTTATAGACCCAAAGTTTATAAGTCAAAA[T/G]
TTTACATACCCAATTCAAATTTGAATTTGAATTTGTATCCGATTCAAATTTGAATTTGAATTATATCCGATTCAAATTTGAATTTGAATTCAAATATTTT

Reverse complement sequence

AAAATATTTGAATTCAAATTCAAATTTGAATCGGATATAATTCAAATTCAAATTTGAATCGGATACAAATTCAAATTCAAATTTGAATTGGGTATGTAAA[A/C]
TTTTGACTTATAAACTTTGGGTCTATAAACTTTAGGTGTATAAACTTTAGATGTATCTAAATACTATATATAAAAAAATATTTGAATTTAAATTCAAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.20%	18.60%	17.48%	4.72%	NA
All Indica	2759	70.30%	0.50%	21.75%	7.47%	NA
All Japonica	1512	39.90%	55.20%	4.30%	0.53%	NA
Aus	269	45.00%	0.00%	53.16%	1.86%	NA
Indica I	595	64.20%	0.00%	26.55%	9.24%	NA
Indica II	465	68.80%	1.50%	18.06%	11.61%	NA
Indica III	913	80.60%	0.00%	16.54%	2.85%	NA
Indica Intermediate	786	63.90%	0.80%	26.34%	9.03%	NA
Temperate Japonica	767	7.40%	90.60%	1.43%	0.52%	NA
Tropical Japonica	504	88.10%	3.20%	8.13%	0.60%	NA
Japonica Intermediate	241	42.70%	51.50%	5.39%	0.41%	NA
VI/Aromatic	96	78.10%	17.70%	4.17%	0.00%	NA
Intermediate	90	65.60%	14.40%	15.56%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0104428821	T -> G	LOC_Os01g08814.1	upstream_gene_variant ; 1937.0bp to feature; MODIFIER	silent_mutation	Average:19.556; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0104428821	T -> G	LOC_Os01g08814.2	upstream_gene_variant ; 1937.0bp to feature; MODIFIER	silent_mutation	Average:19.556; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0104428821	T -> G	LOC_Os01g08814.3	upstream_gene_variant ; 1937.0bp to feature; MODIFIER	silent_mutation	Average:19.556; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0104428821	T -> G	LOC_Os01g08820.1	downstream_gene_variant ; 2711.0bp to feature; MODIFIER	silent_mutation	Average:19.556; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0104428821	T -> G	LOC_Os01g08814-LOC_Os01g08820	intergenic_region ; MODIFIER	silent_mutation	Average:19.556; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0104428821	T -> DEL	N	N	silent_mutation	Average:19.556; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0104428821	NA	2.28E-13	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0104428821	NA	3.25E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	4.97E-19	mr1308	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	8.06E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	1.82E-08	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	1.04E-09	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	8.88E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	4.38E-15	mr1401	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	2.01E-08	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	1.15E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	3.31E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	5.68E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	1.60E-10	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	2.48E-21	mr1584	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	6.66E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	1.27E-07	mr1606	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	3.46E-07	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	2.02E-17	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	9.46E-07	NA	mr1852	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	6.66E-06	NA	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	3.65E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	6.09E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	1.09E-06	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	2.12E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104428821	NA	1.53E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251