\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104411747:

Variant ID: vg0104411747 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4411747
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAGACTGGCTTATGCCTAAAAGGGGGGACTTGAAGCTAGGAACTACTACGACGGTTAAAAACGCAACTCCAAACAGCGGGAGGGGGCAGAGCCACGCTA[C/T]
ACTACCAAGAAATCCCCCAAAAAAAGCAACGCCGACTAAAGACCACAGCTGGCCCTCCGAACGGATGGACTCCAGAACCACTGCGACCGAAGCGAGCGCA

Reverse complement sequence

TGCGCTCGCTTCGGTCGCAGTGGTTCTGGAGTCCATCCGTTCGGAGGGCCAGCTGTGGTCTTTAGTCGGCGTTGCTTTTTTTGGGGGATTTCTTGGTAGT[G/A]
TAGCGTGGCTCTGCCCCCTCCCGCTGTTTGGAGTTGCGTTTTTAACCGTCGTAGTAGTTCCTAGCTTCAAGTCCCCCCTTTTAGGCATAAGCCAGTCTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.50% 14.20% 0.85% 0.47% NA
All Indica  2759 97.40% 0.60% 1.23% 0.80% NA
All Japonica  1512 59.00% 40.90% 0.13% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.50% 0.00% 0.50% 0.00% NA
Indica II  465 92.00% 0.40% 4.52% 3.01% NA
Indica III  913 98.80% 0.90% 0.00% 0.33% NA
Indica Intermediate  786 97.20% 0.90% 1.27% 0.64% NA
Temperate Japonica  767 93.20% 6.80% 0.00% 0.00% NA
Tropical Japonica  504 8.70% 91.10% 0.20% 0.00% NA
Japonica Intermediate  241 55.20% 44.40% 0.41% 0.00% NA
VI/Aromatic  96 76.00% 21.90% 2.08% 0.00% NA
Intermediate  90 84.40% 13.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104411747 C -> T LOC_Os01g08780.1 upstream_gene_variant ; 4455.0bp to feature; MODIFIER silent_mutation Average:53.193; most accessible tissue: Minghui63 root, score: 85.36 N N N N
vg0104411747 C -> T LOC_Os01g08790.1 upstream_gene_variant ; 3669.0bp to feature; MODIFIER silent_mutation Average:53.193; most accessible tissue: Minghui63 root, score: 85.36 N N N N
vg0104411747 C -> T LOC_Os01g08780-LOC_Os01g08790 intergenic_region ; MODIFIER silent_mutation Average:53.193; most accessible tissue: Minghui63 root, score: 85.36 N N N N
vg0104411747 C -> DEL N N silent_mutation Average:53.193; most accessible tissue: Minghui63 root, score: 85.36 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0104411747 C T 0.02 0.03 0.02 -0.01 -0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104411747 NA 7.20E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0104411747 NA 3.37E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 9.97E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 2.63E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 6.95E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 8.03E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 3.12E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 9.19E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 3.43E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 1.13E-07 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 1.14E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 1.03E-06 5.07E-08 mr1852 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 1.13E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 1.64E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 2.80E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 6.44E-07 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 1.33E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 6.34E-11 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 1.72E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 4.17E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 5.69E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 2.37E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 2.05E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 2.06E-32 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 5.29E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 3.19E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 9.23E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 1.10E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 2.01E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104411747 NA 1.49E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251