\
| Variant ID: vg0104403637 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 4403637 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, G: 0.47, others allele: 0.00, population size: 76. )
TTTTAACTTTTTCCTTTTGTTTTTTATTTTCCTATGCGTAAGGGTAAATTGGACAAATCATATAGATTTTGCATGAATGATGACATGGCATGTCCATGTG[G/A]
CGATTTTGGTGGGACCAAGGACTATATCAGTCCACATGATAAATTTAAAGGACTTGTTTGGACAATATAAAATATTAAGGACTAAAATGATCCAGGAGCG
CGCTCCTGGATCATTTTAGTCCTTAATATTTTATATTGTCCAAACAAGTCCTTTAAATTTATCATGTGGACTGATATAGTCCTTGGTCCCACCAAAATCG[C/T]
CACATGGACATGCCATGTCATCATTCATGCAAAATCTATATGATTTGTCCAATTTACCCTTACGCATAGGAAAATAAAAAACAAAAGGAAAAAGTTAAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.60% | 19.20% | 15.21% | 5.97% | NA |
| All Indica | 2759 | 64.80% | 1.20% | 24.14% | 9.86% | NA |
| All Japonica | 1512 | 44.50% | 54.90% | 0.53% | 0.07% | NA |
| Aus | 269 | 91.10% | 3.00% | 4.46% | 1.49% | NA |
| Indica I | 595 | 61.20% | 0.20% | 32.44% | 6.22% | NA |
| Indica II | 465 | 50.30% | 1.70% | 33.98% | 13.98% | NA |
| Indica III | 913 | 69.30% | 1.00% | 17.74% | 11.94% | NA |
| Indica Intermediate | 786 | 70.70% | 2.00% | 19.47% | 7.76% | NA |
| Temperate Japonica | 767 | 9.50% | 89.70% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 3.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 47.70% | 51.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 61.50% | 19.80% | 15.62% | 3.12% | NA |
| Intermediate | 90 | 61.10% | 16.70% | 20.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0104403637 | G -> A | LOC_Os01g08770.1 | downstream_gene_variant ; 1556.0bp to feature; MODIFIER | silent_mutation | Average:38.363; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0104403637 | G -> A | LOC_Os01g08780.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.363; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0104403637 | G -> DEL | N | N | silent_mutation | Average:38.363; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0104403637 | NA | 4.40E-13 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0104403637 | NA | 1.07E-19 | mr1308 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 1.03E-06 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 7.74E-08 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 5.71E-11 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 2.08E-15 | mr1401 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 8.41E-08 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 6.62E-07 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 5.57E-10 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 5.70E-24 | mr1584 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 1.15E-07 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 3.71E-07 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 3.32E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 1.19E-16 | mr1830 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 4.07E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 6.18E-18 | mr1156_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 2.73E-06 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 1.97E-08 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 1.04E-09 | mr1825_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104403637 | NA | 6.88E-08 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |