\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104403637:

Variant ID: vg0104403637 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4403637
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, G: 0.47, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTAACTTTTTCCTTTTGTTTTTTATTTTCCTATGCGTAAGGGTAAATTGGACAAATCATATAGATTTTGCATGAATGATGACATGGCATGTCCATGTG[G/A]
CGATTTTGGTGGGACCAAGGACTATATCAGTCCACATGATAAATTTAAAGGACTTGTTTGGACAATATAAAATATTAAGGACTAAAATGATCCAGGAGCG

Reverse complement sequence

CGCTCCTGGATCATTTTAGTCCTTAATATTTTATATTGTCCAAACAAGTCCTTTAAATTTATCATGTGGACTGATATAGTCCTTGGTCCCACCAAAATCG[C/T]
CACATGGACATGCCATGTCATCATTCATGCAAAATCTATATGATTTGTCCAATTTACCCTTACGCATAGGAAAATAAAAAACAAAAGGAAAAAGTTAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 19.20% 15.21% 5.97% NA
All Indica  2759 64.80% 1.20% 24.14% 9.86% NA
All Japonica  1512 44.50% 54.90% 0.53% 0.07% NA
Aus  269 91.10% 3.00% 4.46% 1.49% NA
Indica I  595 61.20% 0.20% 32.44% 6.22% NA
Indica II  465 50.30% 1.70% 33.98% 13.98% NA
Indica III  913 69.30% 1.00% 17.74% 11.94% NA
Indica Intermediate  786 70.70% 2.00% 19.47% 7.76% NA
Temperate Japonica  767 9.50% 89.70% 0.78% 0.00% NA
Tropical Japonica  504 96.20% 3.40% 0.40% 0.00% NA
Japonica Intermediate  241 47.70% 51.90% 0.00% 0.41% NA
VI/Aromatic  96 61.50% 19.80% 15.62% 3.12% NA
Intermediate  90 61.10% 16.70% 20.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104403637 G -> A LOC_Os01g08770.1 downstream_gene_variant ; 1556.0bp to feature; MODIFIER silent_mutation Average:38.363; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0104403637 G -> A LOC_Os01g08780.1 intron_variant ; MODIFIER silent_mutation Average:38.363; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0104403637 G -> DEL N N silent_mutation Average:38.363; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104403637 NA 4.40E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0104403637 NA 1.07E-19 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 1.03E-06 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 7.74E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 5.71E-11 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 2.08E-15 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 8.41E-08 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 6.62E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 5.57E-10 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 5.70E-24 mr1584 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 1.15E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 3.71E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 3.32E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 1.19E-16 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 4.07E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 6.18E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 2.73E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 1.97E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 1.04E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104403637 NA 6.88E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251